GenePrediction:GLEAN_7993 Details

Name: GLEAN_7993
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1783391..1782926 (- strand)
Length: 466
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1783391..1783094 (- strand)
Length: 298
Type: CDS
Source: GLEAN
Position: GCSC_113:1782987..1782926 (- strand)
Length: 62
>GLEAN_7993 class=GenePrediction position=GCSC_113:1783391..1782926 (- strand)
ATGGGAAGAGAACGAGAACGAAACAGCAACGGGACTGGGCAGAAGACACTGATAAATACGACTGCTTATCCTCTCGGGGA
GCCGACAGGGGACGAGCAAAGCGGCCTCGTCGAGCAGAGGGATTGGCGGGATGGATTTGCAAGCTTGGTTGGCGGTGCCT
TGGCTGCCCTGGCCCGCCGTTTCTCCAGGCTCAGCACGCTGAGTGGCGCAGGAGACAGTCGCTCGTTGGTGGAGCAGCCT
GCCACGATTGCCCGAAGAGGACTAGCGGCATGGCTCAGCCCCGGCTACGTGTATACGAGTACGTATACGTATTTTCTGTC
ATGTTTCTGGGCACAGCCGCAGCGAGTGCGGCCAGGCTGGGAGATCTGGGGGAGGAAGACGTGAACGTATCTTACTCCGT
ACAGAACACGAGACATCCGTTCCAGTGGTTTGCGAGCTCTGCACGACCAAGATGAGACCCTTCTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62