GenePrediction:GLEAN_7994 Details

Name: GLEAN_7994
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1779726..1777996 (- strand)
Length: 1731
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1779726..1778305 (- strand)
Length: 1422
Type: CDS
Source: GLEAN
Position: GCSC_113:1778240..1778088 (- strand)
Length: 153
Type: CDS
Source: GLEAN
Position: GCSC_113:1778025..1777996 (- strand)
Length: 30
>GLEAN_7994 class=GenePrediction position=GCSC_113:1779726..1777996 (- strand)
ATGGGAAACCAGAGTTCCAAGGAAGGCGGCAGTTCAAAGGCATCGGGCGCTGATGGCCTGCAGTCCTACCCTTCTTTCAG
TCGCTCTGACACCAAAGACTCGACGCGCTCCTTCCGCTCTTTGCGATCCAAGATCCCCGGTGGGAAAAATGACAGCCCAC
GCTCCTCCGCCATTCTCACCGGTGGCGAAGCTGGTGCCGAAAGATCAGATGCCATCTCGAGCCGACCGAACCGATCGTCT
ATGCCACCGTCCTCACGTCTGAACCGGTCCGACTTCGGCTCCTCTCCGACATCAGTCTCATCGTCAATCGACAACAACCA
ACCCTCGTCGCCGCTAAGCGATGATGGCAGGCAGCCACCGCCGTCGCCAATCCAGTCGGCCTCTATGAAGTCGGGCAGAC
ATAATGTCAGCTCGGCCCAGGCCAGCGGCGAGGTCGATCACGTGTCCGAATCACCACCGTCTGCAAGTGCCCCAGACCCG
AACATGCCACTGTCGGAACCAGGCCAGTCCATTCTCTCTCGTCGTGACAGCATTGCCAGCAATTCGACCGCCTCAAGGCC
GCTGGCTCCTGGCACTCCTGGCGTCGAGGAGGCCGGCAACATGACCATGGGCGACATCCAGGGCATCGATATCGATGACT
ACATTAAGCGCTTGTTGGATGCTGCCTACGCAGGCAAGGTGACCAAGGCTGCGTGCCTTAAGAACGCCGAAATTGTAGCT
ATTTGCCAGCGCGCTCGCGAATGCTTCCTATCACAGCCGACGCTGCTCGAGCTGGATGCTCCGGTCAAGATCGTTGGCGA
TGTTCACGGCCAGTACACGGACCTGATCCGCATGTTTGAGATGTGCGGCTTCCCCCCGTCATCCAACTTTCTCTTCCTCG
GTGACTACGTCGACCGGGGGAAGCAGTCTCTCGAGACTATCCTACTTCTCATGTGCTACAAGATCAAGTATCCTGAAAAC
TTCTTCTTGCTACGGGGAAATCACGAGTGTGCAAACGTGACACGCGTCTACGGCTTTTACGACGAGTGCAAGCGTCGCTG
CAACGTCAAGATTTGGAAAACTTTCATCGACACATTCAACACTCTGCCCGTGGCTGCCATCGTGGCTGGGAAGATCTTCT
GTGTGCACGGCGGACTGTCGCCTGCTCTCGACCATATGGACGACATTCGCCACATTACCCGGCCAACAGACGTGCCCGAC
TATGGCCTATTGAACGACCTGCTATGGTCCGACCCGGCTGACATGGAGCAAGACTGGGACTCGAACGAGCGCGGCGTCAG
CTACTGTTTCAACAAGAAGGTTATCACTGACTTCTTGGTCAAGCACGACTTTGATCTGGTATGCCGCGCGCATATGGTCG
TTGAGGACGGCTACGAGTTTTTCAGCGACCGGGTATTGGTTACGGTGTTCAGTGCGCCCAACGTAAGTCAAGCTTGTTGT
TTTTGGTTTTTCTGTCCTGCCATGGATCTCACTAACACGGCGTCAGTATTGCGGCGAATTCGACAATTGGGGCGCTGTGA
TGTCGGTCTCGTCGGAGCTGCTCTGCAGCTTTGAGCTTCTCAAACCACTGGACTCGAATGGGCTGAAGAGCCACATCAAG
AAGCAGAGAAATAACCGCAAGAATTTTATCAACAGCCCTGTAAGTAAACCCAGCGCAAAACTAATGTCTGAGCCCAATTT
ACTGATGCATTAAACTGCCAGCCTGCCAATGTGTATCCTCAGAGTGTGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62