GenePrediction:GLEAN_7995 Details

Name: GLEAN_7995
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1768387..1765281 (- strand)
Length: 3107
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1768387..1768128 (- strand)
Length: 260
Type: CDS
Source: GLEAN
Position: GCSC_113:1768049..1767277 (- strand)
Length: 773
Type: CDS
Source: GLEAN
Position: GCSC_113:1767223..1765281 (- strand)
Length: 1943
>GLEAN_7995 class=GenePrediction position=GCSC_113:1768387..1765281 (- strand)
ATGGCATCAAGAAAGGCGGCATCGGCGGCCGCGGATGCCCAGAAGAAGCGGAAGCGAGAGAAGATCGAGGACGCAGGCCG
GTCCAAAAAGAGAAAGCCGCAGGACGAGAAGAACAAGGGTGCGATTGTGGTGAAGCAGGCCGGAGAGACGACCGAGCCGG
TTGTGGTCCGACAGAGCAGTCGGCCGACGTTGTGGAAGCTGTCGGAGCCCATGGGCGGCTGCATGTCCGACATCGACCCA
ATTTTTACGGCCGACGAAGGGTTTGTCTGACGGTTTTCTTCATGTGCTGAGGACGGTCGAGCGCTGACACGTGGCAGACG
CCTCATTCTCGCATACAGATCGTCGATTCAGGTGTACTCGACTGCCGACTCCCTCCTAGAGCGTCGCATCAAGCTGCCGC
AGCCGGACGGCGCAGCCGAGCGCGCCGGCCACATTGTTGGGGCCGTGCTGTCGCCGCTGGCCGAGGAGATCGTCTGGGTC
GGCTGTGCGGACGGATCCATCTTCTTGGTCAACTGGTTGTCGGGCGCGGTGGAGCGGCTGAGCCGGCAGCAGGAGCCGGC
ACCCAAGCTGGTCGGCCTGGCCGTCGAGCTCGTCCACGTGGCCCATCAGCCGAAAGAGGTACTCTTCCTCTCAGAGGGCT
CGCGTGGTGCATGGCATGTGACGGCCTACGACACTGCAGCGCTGGCCACGTTGCCCGGCCGCACGCTGTTCTCGCACAAC
GGAGCCACGGCCATCGAGCACCTGCGCACGGTCAACCACGGGCGGATCGTGGTCGGCGCCAGCGGCCAGACCGTCTTCGT
CGGCGAGTTGCAGCTGGCCGAGGGCCGCATGCCCGTAGCCGTGGCCGAGCTGACCTACCAGTTCTTCTCCGTCGACGCGG
TCGACGAGGTGTCCTGCCTAGACCTCCGGACGACGACGAAGAAGCGCGGTCCTGTACTCGACCTCGTGCTGGGCTGTGTG
CGGGGTGCCATTTACGTGTACGCCGACGTGCTCTTCCGGCTACAAAACGCCGCAGCAGAGGGCGCCCGGAAGAAGGCCGT
GGCGGGCATCCACCCGCGCAAATACCACTGGCACTCGCGGTCGGTGTATGCAGTGAAGTGGTCGCGAGACGGTAGGCAGA
AAGCCGACCTTGGTTTCTGGCCCGATGGCTGACAGGTGCTGCAGGAAACTACTTTATCTCGGGCGGAGCAGAAACGGTGC
TCGTGCTGTGGCAGACCGATACGGGCCGGCTGTCGTTCCTGCCGCATTTGGCGGCCAGCATCGAGAACATTGTGGTATCG
CCACGCGGATCATCGTACGCCATCCACCTGGACGACAACTCGATGATGGTGGTGTCGACGGCCGAGATGAAACCGACGTG
CTACGTGTCGGGACTGCAATCGCTGGCGTTTGCGTCGGCGCCGCGCAAGGACGCAAGCGTGCGTCGGGCCTGGCAGCCGA
TCGAGACCATCACGCATCCGGTGCCAGCGGTGATCAGCCCGACAGATGCATCGCGGATTCTGCTGCGCGTGGGCAACGGC
CAGAAGAACACGATGGTGGGCGAGGTTCCATCGGCCTCGCTGCTGCAGACGTTTGACATTGGGGCCTTCCAGAGTGTGGC
CAAGCAGCCGCTGGCCCGGACGAACCCGACTGACTCCAATCTGACGCTGCGCGGCCACCCGGTGACGGAGCCGACGATCA
CGCAGCTGTGCACGTCGCTCGACGGCAAGTGGCTCGTGTCCGTGGACGAATGGCAGCCGCCACCGCGCGACATCAGCGGC
ATCGCCGGCGAGCCGTCACTGCAGGACGACTGGGCGCGGGAGCGGCGCGAGATCCACCTCAAGTTTTGGGCGAGCGTGGA
TGGCGGCAGCAGCGGAGAGGCTCCGGCCTATGAGCTGGTGTCGCGCGTGGACGAGGCGCACCGCACGACGCAAGTCGAGC
CGATCCTGGGCGTCGCAGCTGACAGCGGGCGGGCGAACCGATTTGCCACGCTGGGCGACGACGCCGTGGTTCGGTTCTGG
GGCTTGCGGCAGCGCGTGCACGACGGCCTGGCCGCCAAGGATGACAAGGGTCGGGCGCTGGTCAGCTGGCACTGCACGCA
GGAGGTAGTGCTGCCGCTGGGCGAAGGCGGCAGCCAGAGCGTTGTCGGTCGTGACGGGCTCATCGCCCGCGAGCCCAAGA
CCAAGGCGCGGCGCAGCGGCGCCCTCACCTTCTCCGACGACGGTTCGACCGTGTTTGTCGCCTTTGGCGCCCCCGATGAG
GCCGTGCTGTACACCATCGACGCCGAGTCGGGAGCTGTGCGCGCCTCGCTGCAGGGAATGTTTCGTGGCGATGTGCGCGG
CGTCGAGAGCCTCGGGGCCACGCTGGTGCTGCTGTCCGAGGACCTGCGGGTATACGATGTCGTGGCCGATGAGCTGCGGT
ATGGCGTGCGGCTGCTAGGTGTCGAGAGCGAGAGCCAGGTCGGAGACGAGACAGAGGAGAAAAAGAACAAGACGGTTGCT
GAGTCATCTGCTTACTCAGCATTGACGCAGCTCGTGGTTGGGCGCCAGTCGCAGACGTTTGCGGTCGCCGTGCCTCGCGC
ATCCTCGGCCCGGCAGGCGGCTTCGCGGCTGATGGTGTTCTCGCCAGAGCACGCCCAGCCGCTGCTGGTCGAGGACCTGC
CGCACCTGGTGGTGTCGCTGCTGCCGGCCGTGGGCCTGTCGGGCTTCCTGGCCATCGACGCGACGGCGCAGATCTGGTCG
GTGGTGGACGCAGCCGACACAGCCGCTCTGGGACGGCCGCTTTCGGATCTGAACCTGCCGATGACTGTGGCAGTGACTGC
AGTTGAAAAACAGCTGCAGCTTGCAGACGGCGACGGGGAGGACAACGAGATGGCGGACGTCGACGGCGCAGTCGAGGACG
AGTCTGACGACGAGGCAACCAAAGACGGAGACGAGGATGAAGACGACGAAGACGAGGACGACGAAGACGAAGAACAAGAC
TCGCATGCAGCCGTGATTGCGCCGCAGAAGCTGCGCGACATCTTTGACGCTGCGCCAACGACGTCGGCGTCGATTGAAGA
GCTCTTCTGGCAGGTGTCAGGCCTTCTGTCAGCACTGCCGCAGCTGGTGCCGGCCGGACGGACGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62