GenePrediction:GLEAN_7996 Details

Name: GLEAN_7996
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1765026..1763708 (- strand)
Length: 1319
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1765026..1764827 (- strand)
Length: 200
Type: CDS
Source: GLEAN
Position: GCSC_113:1764722..1763708 (- strand)
Length: 1015
>GLEAN_7996 class=GenePrediction position=GCSC_113:1765026..1763708 (- strand)
ATGTCATTTACGTCAATCCCCATTCTCGACCTGAGCCGATCGCGCAATCCGGACACCAAGCCGGCCTTTCTGGCAGAGCT
GCGCGACGCCCTCATCGAGGTCGGCTTCTTCTACATTAAGAATGTCGGCATCCCGGACGAGCTCTTTCGACGGGTAATAG
AGCAAGGCCGAGCATTCTTTGACATTCCCGAGGAGGAGAAGTAATAGGTTTTCCCTTATGTTGCTTTCTTCCTCTCTGTT
CTGCCCTCTCTTCAGCTCTCTGGCTCATCACACCACGTCTCCCCCACTAACACCCACACTCCAGACTCAAGATCGAGATG
AAAAATGCCCCGTCGTTCCTGGGCTACTCCCGGCTCTCGGCAGAGATTACGGCTGGTGCGGCTGACCACCGGGAGCAGAT
CGACCTGTCGACGGAGCACGCCGAGCCGGTGCCGGACGCGCCGCGCTACGAGCACCTGCTGGCACCCAACCAGTGGCCGT
CCGCCGCCGTCCTGCCGGACTTCCGACCGGCCTTCTCTGAATTTCTCGACCGCATGGGCGCCATGTCGCTCGACTTCACC
GCGCTCATGGCCGAAGCCATTGGCCTGCCGGCCACGGCCTTTGACCGGTATTTTGACCCGGATCCGGCCCGCCGCCAGCA
CAAGCTCAAGGTGGTCAAATACCCGGACGAGGCAGAGCTGGGGGTCGGCAATGGCGACGGCAGCAGCCAGGGCGTCGGCC
CCCACAAGGACAGCATGTACACGACCTTTCTGCTGCAAGCGAGCGCGCACCACGGGCTGCAGGCACAGAACACGCACGGC
CAGTGGGTGGACGCGCCGCCAATCGACGGCACGCTCGTCGTCGTGATCGGACAGGGGATCGAGGCCCTGACCCAGGGCGT
CTGCGTGTCGACAACACACCGGGTGGTGTCGCCGCCAGCCGGCGCCGGTGCCCGCTTCTCCATTCCGTTCTTCCAGGGCG
TCCGGCTGGACACGGCGTTTGAGGAGCTGGAGCGTGTCGGCATCGGCGCCGTGCCAGAGCCCGTCAAGGACCAGCGGCGC
GCCGTGCTGGCAGCTGCCGCCGCCGCCAACGGAGGCCGTCTGGACGACGTCGAGTTCACCTTCCGTACCGGCGGCGCGGC
CAAGACGCTCGGCGAGGCCACGCTCCGCAACCGCGTCAAGAGCCACCCCGACGTCGGCGAGCGCTGGTTCCCGGACATTC
TCGCAGACATCCGGGCAGAGGAGCGGCAGCAGCAGAGGAAGAAGGGGGATGGGGAGGCCGTCCGGCCAGGCGAGACGTCG
TCTGCTGTTGGTGCAGCCGTAGCCGTCCCAGCCCACTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62