GenePrediction:GLEAN_7997 Details

Name: GLEAN_7997
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1762788..1761840 (- strand)
Length: 949
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1762788..1762680 (- strand)
Length: 109
Type: CDS
Source: GLEAN
Position: GCSC_113:1762609..1762477 (- strand)
Length: 133
Type: CDS
Source: GLEAN
Position: GCSC_113:1762413..1761840 (- strand)
Length: 574
>GLEAN_7997 class=GenePrediction position=GCSC_113:1762788..1761840 (- strand)
ATGAACGTGTCTGCTATTCCGTCGCCCGACAACATTTCCATTGACGAGTTTGAGCAGCTGCTGGCTCGCTATCCGGCCGT
GCTGCAGGCCGTCTCGGATGCCAAAGGAGGTGAGAGCGCCAGAGAGCTGTCGCTGCTGCTGCTGCCCGCGTATCTCTGAC
CATCATCCCGTCTCCTCAGCCAAGACTGGACAGCAGACATTGGCCGAGCTCGATGCGTTCCGCTATCAAGTAGCGCCGGC
TCGCTTCGGCCTCGATGAAGGGGCTCAGCTGATGACGCTCGATGACGTCAAGCAGCTCGTGGCTTGGAAGCTGTGAGTTC
GCGGCCAGGAGAGACAGCTGCGCCACGAAAGATGGAAGCCTGACAGCTCGTGCAGTCGCCACGGCAAGTTCCGTCCGAAC
CTCATGAAGCTAGTCTCGTCCAACGACGAGGCCGCCGTGCGCGACGCCGTGCGCGAAGCCCTGGACGTCTACCGGCCCCC
GAAAGGCGGAGACGATAGGACAACGTCTTCCTCTCTGGCTTTCCGCGCCCTCTGTCGCCTCCGCGGCATTGGCCCAGCCA
CCGCGTCTCTGCTGCTGGCTGTGCACGACCCACAGCACGTCGTCTTCTTCGCCGACGCAGCATATGCGTGGCTGTGCGGC
GGGCCTGCGCTGGCACCGCCCAGCAAGTACAACGACCGCGAGTACGAAGACTTGAGCAGCCGCGCCGCAGCGCTGCAGAA
ACGGCTGGCCCGCAATGGCAGCGCAGCAGACGTGGAAAAGGTGGCTTACGTGCTGCTGACTGAGGGCAACAACAATACGG
GTGGGGCCAGGAGACGACAGACGAAAGAGGCCGAAACAACAGAACGTCCGGCGGAACCGGTGAGCAAGAGGAAACGCTCG
TCTGCCGCTGATCCAGAGCGGGTGGACAGCGCTCCTCCCCGTCGGTCCCAACGTGTCAAACGAGCATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62