GenePrediction:GLEAN_799 Details

Name: GLEAN_799
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_132:61661..63749 (+ strand)
Length: 2089
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_132:61661..61741 (+ strand)
Length: 81
Type: CDS
Source: GLEAN
Position: GCSC_132:61833..61856 (+ strand)
Length: 24
Type: CDS
Source: GLEAN
Position: GCSC_132:61923..63749 (+ strand)
Length: 1827
>GLEAN_799 class=GenePrediction position=GCSC_132:61661..63749 (+ strand)
ATGGGCCCCTACAAACTACCGACGACTGGCAAAGCCATAACTGACCTTACCGTTCTTCCGACAGTCAGCAAATCCCGAAA
GGTACGTTTCCAGCATTTGCGACTGTACTGCTGGTTCCAGTGAGAGAGCCTACCATGTTGACGTCTGAACTAACAATGCC
CGTCTCTTGCAGCCTCGCTTTGAACTACATCTTAAGGTCAGTGAATGTTGTATTAGCTCTGCAATCGTCCGGCAACGTGC
ACCCGCATGCTAACCTTTCCAGGTTTACGACCTCAACAACATCCCACTGGCGTCCGGCACGGCCTTTGTCAAATGGCATC
TTCCCTACAGCATTCACAGCGAGCACCGCGGTCGGTCGTCCAAACATAATGTCGCAAACCACCGAGTGGAATTCAACTAT
GCGAAGATTGTTCCACTGCGCCTGGTCATTGACAAAAACAATCGCCTCAGCGACTACCCCATCGAGTTCGAGGTCACTCA
AGAATTCAGCAACAACGGCGTCGGTCGCGACGAGAAGATTGTCCTCGGCAAGATCACATTGAACCTGGCTGAATATGTGG
CTGAGAGCGAGGCTATGCTCCGGGATTTACGGCCTGCTTCAGGCCACAGCGATACGGCGCGCTGGAACTTCCCCAGCGCA
ACGGAGAGCCACCACACGCGGCAACGCAGCTCGCTGAGCGCAAAGGGCACGATCAGCAGCTTTAGCACAGGCCTGGGGGT
ATTCGACAGCGGTGATGGTGCTGAGTCTATGCTGTCTACCTCGCCGTCCGGTGTGTCTGGGCCGCCCCATTCTGCAGGAT
CGTCCGCTTCGACCGGCACACCCTTGGTCGAAGAAGGCGTGACGCGACGTTATCTCATGCAGGAGAGCAAGATCAATGGC
ACCCTGAAAATAAGCGTGCTCATGGTCCAGGTGGACGGCGATCGCAGCTTTGTATCCCCGCCTCTAAAATCTGCCCCCGT
CTTTGGCGGTATTGCCGGCATCATGGCGAGTGGTGAGGTTCTGGGTGGCGGTGTTGTGAGCCTACATGACGACTTGGATG
ATCCTTCGGCCTCTATAGGAGGTGGGGCCGGATCGAGAGCGTCACGCGCGGCTGCGAAGGGTCGCGACGTCTCCGAGGTT
CAAGACGTATACCGACGTGCGCTGGCCGCATCGTGGGCTTGCGAGCAGGGCGAGCTACCGGCAGACGAATGCATCGAGGA
CATTTTCAACGGCGGTGATGGTTTCCGACGCCCGGCCGGTGGCAACACGCCTGACTCTCCTCCAGTTGGACGCACGCTTC
CGTCTAATTCGTCACTGCACTCAGTGACCGAGGACCAGGATAAAGATAGCGAGGGAAGCGGTTTGGGAGGCAGTGGTTCG
TCTGAAAGAAAGAAGGGGCACCGGTTTATTCCAAAGTTGCCCCTGCGGCGCAAGACGGCGCCAACAAATATCGACTCAGC
GCAGAAGACGCTGCACAAGGCGAACAGCAGTAACGCTCTGAGAGGAAAGGGTGGTGTCGGCGCTCAGTTTGATGCCGGTG
GTAATAACAGCAGCAGCGGAGAAGAGGGTGACACCACGAGCAGTGGTAGTACTGGCAGGCCAGGCACGGGCATGACGTAT
AACCCGCACGCCGATGACGACGGTGGCTTTGAAATCAATGCAACTCTGAGACCGTACGACTTGCGTCAACTCCGCAAACC
GCTGGCAGTCTCGTCAGATCCGGCATTTGCAGCAATACGACAGCATGAGCGCGAGGACAGTGTTCTGTCTGACCGAACAA
TAAAGGGACCCGGCAACGCTGGCAGTTTTGACGTCCCTAGGTCCGCGCGAAGCAGCCCTGGGCCGGGCTTCGTGTCCTCT
AGGCTTCTACGAGACAATGCTTTTGGGGGGCTAGCATCTTCACCAATGCCAGCGGGAAACAGTAGCCACTGGAGAAGTCA
TGGGGAAGAAAGAGGACGTCAATCATCAGGCCACGGTAGAGATGATGGTAATCGCGGTGGCAGTGGTGCTGACGAGGACC
AGAGCTTCAAGTCGCAGGACGTCGACGAGAATGATGTACGTGAGAACTTCATGGCATGGCAAATGTCGAGCTCGGTGGCT
GCGTCTTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62