GenePrediction:GLEAN_79 Details

Name: GLEAN_79
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_179:515041..517190 (+ strand)
Length: 2150
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_179:515041..515222 (+ strand)
Length: 182
Type: CDS
Source: GLEAN
Position: GCSC_179:515331..515691 (+ strand)
Length: 361
Type: CDS
Source: GLEAN
Position: GCSC_179:515762..515887 (+ strand)
Length: 126
Type: CDS
Source: GLEAN
Position: GCSC_179:515950..516003 (+ strand)
Length: 54
Type: CDS
Source: GLEAN
Position: GCSC_179:516069..517190 (+ strand)
Length: 1122
>GLEAN_79 class=GenePrediction position=GCSC_179:515041..517190 (+ strand)
ATGATCTCCCCCTCGTCGTCCTTTTTGATGACCGGGACACCGTATGGCCAGTCTTCTGCAGTCTCGTCCGGTGTTTCTGC
AGGCGTGGCCGGCCTGCCAACTTCGGGACCAGCAACGTCCCAGCAGATGTCTGCTGCAGTTGTCTCTGCAGGGGCCTCTC
CTATGATGCCCATGGCATCGCCGTACGGACAGCAGCAGCAGCAGCAGCAGCAGCAGCATCCTCCCATGACTATGGGGATG
GCTCCGCCTTCGCTATCCCCCCTGTCTCTGACCTCGTCTCCCCAACGCAGAGGGACTTACATCAGCGGCCTGAGCTCAGA
GGCCGAAGAGGACCAGGCAACTTCTCTAGCTGCAGCACGCAGCATTCAGGGTCGCCGCAGATCCGAACGGCTCGGCCGAG
CTAACCCGTCACCGCCGCCAACAACCGCAGGATCTGCCTCTAGTTCCACGACATCTGGAAATTCATCTGGAGATACCTTC
CGTCCGCAGTTTTCCACACAGGTGGACATTCTCATGCGCACGATCCAGTCTCGTGCGGAGGAGGCGGCCGATAAGAAGAC
ACCTGGCTCCAGCTATCAGCAGAGCCAGGGTCAGTCGCCCATGTACAGCTCGCAGACGATGGGAACGTCTCCGACAGGCA
CCCTGGGAACAGTAAGTGAATCCTCTTGTGATGGGCTATCAACATATTTGCGGCTGCTGACCCGATTTTCTCGTGCGACA
GGAAGACGAAGCCGTCGAGCCTGTGACGAAGCCGTTTGCCTGTACCATCGCAAACTGCACAATGACCTTTTGGCAGAAGA
CACATCTTGATATTCATAAGCGCTCCCATACAGGCGAGAAGCCATATGTAAGACCTTGGTCCTACCTGGACTCTTTCGTT
TGTTTTCAGCTTGCTGACATGCACTCCAGGTCTGCAGCTATGTTGGATGCGGCGCGCACTTCTCCCAGCTCGGCAACCTG
CGTGTAAGTACCGTCAATTAGGGATCTCGTCTGAAGAAAATAGCTGCTAATACGACGTGCAACTGCAGACACATGAGCGA
CGACACACTGGCGAGAAGCCGTTTCGTTGCGACAAATGTGGAAAGTACTTCGCCCAGCGTGGAAACCTCAAGGCCCACGT
CAAGACTCACCTGCGGCTGCAGCCCTATGAGTGCCGTCTCGACTTGTGCAAGAAGCGCTTCACCCAGCTCGGAAATATGA
AGGCCCACCAGAACAAGTACCATGCGACTTCCCTGGCGGCCCTGACAAACAAGTTTGCCCAAGCTGCAGAAGGAGACGAG
GAAGCAGCTGCATCCATCACTGAAGAGGACCGCGAGCTCTTCCAGCACTTTGCCGATCTCTACAAGAATAGCAACAAGGG
CATCAAGGGTCGTGGCAAGCATCGGCGGGTGCGTCCCGTAGTGCCGAAGCTGCCGATCTCAGCAGACATTATGAATTCTG
CGCCAACCTTTGGAAATGACCCAGCATCGTCGTCTCGCCGAACAAGAATCAGCCGGGGCGGAATTCGTGGAGCTGGAGAT
GCAACGCAGCCGAATATGCTGGGCATGCCGGGACCCATGGCGCATCATCCGGCAATAACGCCGACTTCTGCAGATGGATA
CATGGTATACCCGTCTCTTTCAAGTCATTCTCCGTCAGGAGCATCGACGGTTCCATACAGCTCCAGTCTCGGCAAGCTGG
TCAATGGACCCCCCGACAATAGCTCAATCACGGCTGCAGGTCATGGCGGTCACAACGGCCACAACAATGGCAGCGCGTAT
GGCCACCATCACGGACACCCGCCGCCACTGCCGCCACCGTTGCTTCCATCAGGGCCGTACGGAGGCCAGCCGGCCATGAC
GCACAGCATATCATCCTCCCATGCGCATGCGTCGCATCAGGGCCACCATCATCCAGCCCATCAGCATCCACACGGCAACC
TGCATGGCCAACCTATGCATGGAATCGCCAGCATCCACGGTCACTCATCGCAGCATGGACACGGCGGTCCCTCGGGGCCG
GTTGGCCCTCACCCAGGCCACCAGCACCATGGCCACCCTGGCCACTCGTCGACTGCCGCCAATGGTCGCCAGCCATCTGC
GACAGGGTTTGTGTCGTACGACAACGATCCTGTACGCGGCAACGGCATGTACGACAATGGTGTGTACTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62