GenePrediction:GLEAN_8000 Details

Name: GLEAN_8000
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1745315..1744414 (- strand)
Length: 902
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1745315..1745278 (- strand)
Length: 38
Type: CDS
Source: GLEAN
Position: GCSC_113:1745106..1745081 (- strand)
Length: 26
Type: CDS
Source: GLEAN
Position: GCSC_113:1745023..1744878 (- strand)
Length: 146
Type: CDS
Source: GLEAN
Position: GCSC_113:1744820..1744683 (- strand)
Length: 138
Type: CDS
Source: GLEAN
Position: GCSC_113:1744614..1744414 (- strand)
Length: 201
>GLEAN_8000 class=GenePrediction position=GCSC_113:1745315..1744414 (- strand)
ATGCCACCAACACAGCTTCCCGAGTCGGGGAATCCTCTGTGAGTTTCCCCCAGTTACCTGTTTCCAATCCCCGCTCCATG
TACAGCATGTGGCGACCTAGCCACGGGAAGATCTCCGAAAATTCAAATATTCACATACCTACACGAGAGTCTCTTGTTGC
GTGTCCATCTGTCTAGCTTGCTGACCGTGGGTTTATGAGATGTCAATAGTGTCTTTTTTGACATAACTATTGGCGGTAAG
TCCTCATGGTCTGCCTCAACAATAAATGGTCTTGCCCGACTAACCTATCCAGGCGAACCACTCGGCCGTATCACTTTTGA
GCTGTTTCAAGATGTTGTCCCCAAGACAACAGAAAACTTCCGCCGCTTCTGCACAGGCGAGGACACTGATTCGCAGGGCC
GTCCTCGGGGCTACAAGGGCAGCAAGTTTCACCGCATAGTAAGAGCAATGTTGTCCTCCTCCTCGTCTCTGCTTGCCCTT
TGGCTCACCACTTAGATTCCGAATTTCATGTGCCAAGGCGGGGACTTCCTTAATGGAAACGGCACCGGCTCCACTTGCAT
ATATGGCGGGAAGGCGTTCCCCGACGAGAACTTTGAGCTGAAGCATGAACAGCCAGGGCTGCTATCTATGGCGGTAGGTT
ATTAACCTATGTCCTAATCTTACTACATATCGTTCTAAAGTAACTAATCTCATTTCAACAGAACGCTGGGCCCAACACGA
ACGGCTCCCAGTTCTTCATCACCACGGTACCTACACCCTTCCTTGACAATAAGCACACTGTCTTCGGCAAGGTGGCCAGC
GGCATGGACGTGGTTCACAAGATGGAACACGTGCGAACAGGTGCACGCGGACGGGACATGCCGGACCTAGATGTCGTGGT
GGCAGAATGTGGTGAGATGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62