GenePrediction:GLEAN_8002 Details

Name: GLEAN_8002
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1722158..1720607 (- strand)
Length: 1552
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1722158..1722098 (- strand)
Length: 61
Type: CDS
Source: GLEAN
Position: GCSC_113:1722039..1720607 (- strand)
Length: 1433
>GLEAN_8002 class=GenePrediction position=GCSC_113:1722158..1720607 (- strand)
ATGGCACAGGCACAGCAGCCATTGACGTCGGCCACGCAGCCGGCGGATGTGTACGGAGGAGGTGAGGAGAGGAAAGAGTA
AAGAGAGAAAAAAACAAAGAGTGAGGCTGACGTGAGCAGATGAGGTGTCTGCGCTGGTGCTGGACCCGGGCTACTGCCAC
ACGCGTGGCGGGTTTGCGGGCGAGGACGTGCCCAAGGCAGTAGTCCCATCGTTCTACGCGCACTACGCGGCCAAGGGGCC
GGTGGGTGGACGCGACCTGTTTGGCGACGAGGTGCTGATCCCGCGGGCGGAGCTGGAGATCCGCAACTACATGAACCGCG
ACAGCGTGGTAGAGGACTGGGACGCGGCGATCCAGCTGTGGGAGCACGTGCTGGTGCGGCGGCTGCAGCCGACGCGGCTG
TCGTCGCTGACGCGGGCCGCCGGGACAACGAGCAAGAACGTCCACAACAACAGCGGAAGCGGGACAGACGACATGGACGT
GGACCTGGAAGCGGGTGAGGTGCAGGAGAAGCCACTGGCGGAGAACCCGCTGCTGATGACGGAGGCGCCGTGGAACAGCG
GCAAGGCGCGGGAGCGGGCGATCGAGGTGGCGATGGAGAGCTGGGGCACGCCGGCGTTCTGGCTGAGCCGCACGCCGGTG
CTGGCGGCCTTTGCGGCCGGCAAGGCGTCGGCCCTGGTGGTCGACGTTGGCGGTGCCGGCACGAGCGTCACGGCTGTGCA
CGACGGCATGGTGCTGCGGCGGTCGATACAGCGGTCGCCGGCCGGCGGCCTCTATCTCTCGGGGCAGATCCGCGAGATGT
GGAAGACGGGTATCGAGCCGGCCGTGCCGATTGTGCCGGGCTTTCTGGTCGAGAGCAAGACGGCCGTCGACGCCGGCGCG
CCCGCTCAGGCTCGTCTGCGCAGCTTTCCCTTTGCCATTCAGCAGTCCTTCCGCGCATACGAGGAGGGGCGCCTGCTGAC
CGAGTTCAAGGAATCCGTCGTCGAGGTCTGGCGAGGTCCCGGTCGCTTTGGCTCGCCCGGCAACGAGGACTTTGCCCGCT
CGCAGCCCGGCCGCGTCTTCGAGATGCCCGACGGGTCCAACCAGATGTGGCGAGAGCAGCGCTACCGCGTCGCCGAGGGC
ATGTGGGACGAGCAGGCCGGCTATGTCGGGGCCGCTCCCGAAGAGACAGCGGCCGCTGAAGATGATTTGTCAGCATTGTC
AGCATCTGTCTATGGGCCGCTGACTAAGGCACAGACCATCCCCGAGCTCGTGCGTGCGGCTGTCGGCAGCGTGGACGCGG
ACCTGCGGCCGTTGCTGCTCGGCAACGTCGTCGTCACCGGCAGCACCAGCCTGCTGACTGGCTTCAACGATCGGCTCAAC
AGCGAGCTGACGGCCATCTGGCCGGGCGTCAAGATTAAGATCCACGCGGCCGGCCTGACCAGCGAGCGGCGCTTCGGCGC
TTGGATCGGCGGCAGCATTCTCGCCAGTCTCGGCACCTTCCACCAGATGTGGATCTCGCGGGCCGAGTATGAGGAGAACG
GTGCGGCCATTGTGGAGAAGCGGTGCAAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62