GenePrediction:GLEAN_8005 Details

Name: GLEAN_8005
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1697025..1695422 (- strand)
Length: 1604
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1697025..1696698 (- strand)
Length: 328
Type: CDS
Source: GLEAN
Position: GCSC_113:1696645..1696328 (- strand)
Length: 318
Type: CDS
Source: GLEAN
Position: GCSC_113:1696260..1695422 (- strand)
Length: 839
>GLEAN_8005 class=GenePrediction position=GCSC_113:1697025..1695422 (- strand)
ATGAAGGGCCACTCTGTGGCAGCTGGCGCCGTGCTGGCTGCGACTGTCAACGCTGCGACTCCCGAAGGCGTTGTGCAGTG
GAACATTGGCAAGCGCCAACCACATCCGCGAGCGATTCGCCGGTCCGTTACCAACACGGACCAGATTACCATCAGCAACA
ACGTCTCCTCGGGCGGCTACTTTGCCGAGTGCGAGGTCGGCACGCCAGCTCAGACGCTCACATTGCAGCTCGACACGGGC
AGCAGTGATACGTGGTTGCCGGCAAGCAATGCGTCTGTCTGTTCGACAAGCCGTCATAGCACCAGCAGTGGCTGTAGCCT
GGGCTCATGTACGTTCGCCTGTGCGGTTGAGCAAGGCTTTATGATGATGCTGACCAACAGTCGACTCCTCTTCCTCATCG
ACCTTTAGTATTGTGAACTCGGACTTTAGCATACAGTATGTAGACGGCAGCGAGTCGGTCGGCGACTACTTTACCGACGT
GTTCGTCATTGGCGGCAGTACTATATCCAATCTCACAATGGGCCTGGGCCTGACGACGGACATCTCCTTTGGCCTGGTGG
GCGTAGGATATGCGTCAAATGAGGCCATTGTGGGCACAGAAGACTCGTTCTCGGCCGAGTACGCCAACCTGCCGGTAGCC
CTCGTCAACTCGGGCATCATCAAGTCTAGGGCGTACAGTCTGTGGCTCAACGACCTCGGTACGTGTTTTTAAATTGTCAT
ACATGCTGCCAAGCAGCCGGATGGACGAGACTGACTCTTTCCCAGATGCCAGCACCGGGAACATCCTCTTTGGCGGGATC
GACACGGAGAAATACGACGGCGAGCTGACGAGTATCGACATTTACAAAGACTCGTCATCGGAGACGTTCACGTCGTTCAT
TGTGGCGCTGACGTCGGTCAACGCGTCGAGCTCGAGCGGCACAGACCTGCTGACGTCGCGTGAGTTCCCGATCAGCGTGG
TGTTGGACTCGGGCACGACGCTCTCGTACGTGCCCAACGACCTGGCCGCACAGATCTGGACAGAGGTGGGCGCGGTGTAC
AGCAGCGATGTCGGGGCGGCGGTGATTCCGTGCAGCAAGGCCGGGGGCGACGGGGTGCTGTCGTTTGGCTTTGCCGGGCC
GGGCGGCCCTGTGATCAACGTGACGATGGACGAGCTCGTTCTGGGCATCGGCTCGGCCACCTTCACGTCGGGCGAGTACA
AGGGCGAGACGGCGTGTGAGTTCGGGATCCAGAACATGACGGGCGACCCGTATATGCTGGGCGACACGTTCTTGCGGTCG
GCCTACGTGGTGTACGACCTGGTCAACAACCAGATCGGGATTGCGCCTACCAAGTTCAACGCCACGGCCACCAACATCGT
GGCGTTTACCAGCTCGGGCGCGGCGATCCCGTCGGCCACGACGGCACCACACCAAGACCAGGTGACCAGCGCGACATCGT
ACACGACGCCGGGTTATGCGGCCTCGTCCGGCTTTTCGTCCTCGGACAGCAGCAGCAGCTCTTCCAAGAACAGCGGGGCA
TCCTCGCTGGTGACGCGGGATGCGCTCCGTGTCGCTCTTACAGGCACGGCCATGTTTCTGACCGGCGGTTTGCTGATGCT
ATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62