GenePrediction:GLEAN_8006 Details

Name: GLEAN_8006
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1695244..1692426 (- strand)
Length: 2819
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1695244..1695171 (- strand)
Length: 74
Type: CDS
Source: GLEAN
Position: GCSC_113:1695047..1692540 (- strand)
Length: 2508
Type: CDS
Source: GLEAN
Position: GCSC_113:1692480..1692426 (- strand)
Length: 55
>GLEAN_8006 class=GenePrediction position=GCSC_113:1695244..1692426 (- strand)
ATGGAAGACATTTTACGATCCACTTACACTGTAGACTGCCGTGAGAAGCGCTGTGATTGGACGGAAGGACGGAAGTAGCG
CTGGTAGCAATTTGGGTGTGGGGGTACAAGCGCTGAAAGGCCGGCCGATAGCACGGCTTTCGATTTTTTCGGCGATTGAA
CATGAACCATTTTCCCCCAACCTGTTTGCGAGCCAAGGCATACCGACGATGAGCAGCGCACGCAGGGCAGTATTGCTGCT
CGGCAGCCCGGGCTGTCGAGCGGGCGCCTCCTCGACGGCGTCATCGATGCTGCTGGGGCGGCGACTCAGCCTCGCATCGA
CACGCTGCAGCAACAGCCGGCTTTCAGGCGGCGCATCGCTTCGGAGCAGCCAGGTGGCCGGCCAGGCTCGACGGCAATGG
TTGAGCGGGAGTTCTCGGCTGCAGGCGGTCAGCGCGGCGGAGGCAGCGTGCGTGAATTGGCGTTGGTGTTGGTGTTGGTG
TTGTTGTGCAAGAATAAGAACTTTTCTGACTTTCCCAGGCTAAAGGCGGCCCAGGATGCCGCGGCGAACTTGACGGCAGA
GTCGGTGGCAGCCAAGATGGACCCGGCCGAGGCGAAGCGGCTGGCGAGCGTGCGGAACATTGGGATAGCGGCACACATTG
ACAGCGGCAAGACGACGGTGACGGAGCGGGTGCTCTTCTACACGGGCCGGATCAAGGCGATCCACGAGGTGCGTGGACGC
GACTCCGTCGGAGCCAAGATGGACTCGATGGAGCTGGAGCGCGAGCGGGGCATCACGATCCAGTCGGCAGCGACGTTCTG
CGACTGGGTCAAGCGGGCGGACGACGGGTCGGGGGCCGAAGAGACGTTCCACGTCAACCTGATCGACACGCCAGGCCACA
TCGACTTCACGATCGAGGTGGAGCGGGCACTACGCGTGCTGGACGGGGCCGTGATGATTCTGTGTGCCGTCAGCGGGGTG
CAGAGCCAGACGATCACGGTGGACCGGCAGATGAAGCGCTACAACGTGCCGCGCATCAGTTTTGTCAACAAGATGGACCG
CATGGGGGCGAATCCGTGGAAGGCGGTCGAGGGGATCAACAGCAAGCTCAAGATCGCGGCGGCCGCACTGCAGATCCCGA
TCGGGACCGAGAAGGAGTTTGAGGGTGTCGTCGATCTGATCCATATGCGGGCCATCCGCAACCAGGGTCAGCGTGGCGTG
AACATGAAGATCACGGACGAGATCCCGGCCGAGCTGGTGGAACTGGCCCGCGAAAAGCGCCAGGAGCTGATCGAGAAGCT
GGCCGACGTGGACGACGAGATGGCCGAGCTCTTCCTGGACGAGCAGGAGCCGACGCCGGCACAGATCAAGGCGGCCATCC
GGCGGGCCACCATCGGACTGCGCTTCACACCCGTGCTGATGGGCACCGCTCTGGGCGACAAGGCCGTGCAGCCGATGCTG
GATGCCGTGTGCGACTACCTGCCGAATCCGGGCGAGGTGGCCAACACGGCACTGGACCGCGCACAGGCCGAGAAGAGCGT
GCCGCTGGTGCCGTACAACTCGCTGCCTTTTGTCGGCCTGGCCTTTAAGCTGGAGGAGAACCCGTACGGCCAGCTGACGT
ATGTGCGCGTGTATCAGGGCACGCTGAAGAAAGGCACGTACCTCTACAACTCGCGCACCGGCAAGAAGGTTCGCATCCCG
CGCATCGTGCGCATGCACTCCAACGAGATGGAGGACGTGGCCGAGGTCGGTGCCGGCGAGATCTGCGCCGTCTTTGGCGT
CGAGTGCGCCTCGGGCGACACCTTTACCGACGGCCATCTGCCCTACACCATGACGAGCATGTTTGTGCCCGACGCTGTCA
TGTCGCTGTCCATCCGCCCGAAGCGCAGCAGCGATGCCGACGCCTTCAGCAAGGCCATGAACCGCTTCCAGCGCGAGGAT
CCCACCTTTCGTCTGCACGTCGACGAAGAGTCGGAGGAGACCATCATCAGCGGCATGGGCGAGCTGCATCTCGAGATCTA
TGTCGAGCGCCTGCGCCGCGAGTACCGCGTCGACTGTGACGTCGGCCAGCCCCGTGTCGCCTACCGCGAGACCATCTCGC
GCCACGCCGACTTTGACTACCTGCTGAAACGCCAGTCTGGCGGCCCGGGCGACTTTGCCCGCGTCATGGGCTTCATCGAA
CCCAACATCGATCCGGCTGCCAGTCCCGACGACGGCGACGGCGAGGCCAACAAGACCGAGGCCAACAAGTTCGAGCAGCG
CGTCGCCGGCGGCAACATCCCCGACAAGTTCCTCTCCGCCTGCTCCAAGGGTTTCGAGATCGCCTGCGCCAAGGGTCCCC
TCCTCGGCCATCGCGTCATCGGCTCTCGCATGGTCGTCAATGATGGAGCCACTCACGTGACCGACTCATCTGACTACGCC
TTCAGCCTCGCCACCCAGCTCGCCTTCCGCCAGGCTTTTGCTGCTGCCGGCGGCCAGGTTCTCGAGCCGCTCATGCGCAC
TACCATCACCGCCCCCAACGAGTTCCAGGGCAACCTGCTGATGCTCATCAACAAGCGCGGCACCGTCGTCGACACCGAGA
TCGGCCCCGATGACTTTACCCTCGTCGCCGACTGCTCCCTCAACGCCATGTTCGGCTTCAGTACGGACCTGCGTGCCGCC
ACCCAGGGCAAGGGCGAGTTCTCCATGGAGTTCTCCCACTATGCCCCGGCCCCTCCTCATCTGCAGTACGTCTTTCCCTG
CCTTGCATGTTCTGTACGCTGATTCTTACTAACTGTCCCTGCAGAAAGGAGCTCGTGGCCAAGTACGAGAAGGAGCTGGA
GGCCAAGCGGACCAAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62