GenePrediction:GLEAN_8007 Details

Name: GLEAN_8007
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1683579..1681911 (- strand)
Length: 1669
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1683579..1683509 (- strand)
Length: 71
Type: CDS
Source: GLEAN
Position: GCSC_113:1683407..1683333 (- strand)
Length: 75
Type: CDS
Source: GLEAN
Position: GCSC_113:1682802..1681911 (- strand)
Length: 892
>GLEAN_8007 class=GenePrediction position=GCSC_113:1683579..1681911 (- strand)
ATGCTCGAGGCAGACATCAACTACCGGGTCCAGGGTGCTGACTATGGCACACACTGGGCTACCACTCGAAGGTGCGGACA
ACAAACCCTTTGGATTCCCTAGAGGCTGACCAGCCAGATATCGGGCACCATTGCACGGCCAGCACAGTCACACCCGGCTA
ACTTGCAAATAGTCCGCCTAACGGATACAACGATGGGTACCAGAACAGCGGATATGACAATGTCCGTGATCCTTATCGGC
CACCAAGGTAAGGTGACATCGCTGGGAAGCCATTCCCACACATCCCATCGGCCCCATCGGTCTACCCAGCTTCTTGGACT
CTCCCCCTGTCGTCCCCCCTCCTCCTCCCCTTACCCTGCCGGCCGTGCCTTACCCCATGAAGCTCAGCTTGACCTTCACG
GACTTTATTTGAAGTGTCATGAAATAACCTCTATTGCTCTCAAGTGTGCATGTGTCTCGAACCGGCTCGGCTGCATCTCC
TTTCGGCTTCTCATCAACACCCAATGGCTTTTCTGTAGCCACAAATTCTTTTCAGCAAGTTCCTCGGTCCGACCAACAGT
ACCCTTATTCCCCTCCTCCAAGCTATGGCTGGCCACAGTCATCGTACCAGAGTGCACCCAGCTATGGAGCCATTGGCTCT
AACCTCCCATCATACAACAACACCAACAACAATACCAACAACAACAACAATAACAACAACAACAACAACAACAACAATAG
CAACGCTGGCACGCCAAATGGCTGCATCGGCATCTCCAATGGACGTGGTAACTACAGGTTGGAGGACGAGGCTCGGGCAC
GTGACGTCCTAGCCAGCATCATGCCGATGGCTACCGATGACAGCATGGATCGCCCATCACACAACAGGCGCCGCCAGTCC
AGCTTCCAGTCCAGCTTCCAGTCCAGCTTCTCCCCGAACGGCTCAGGTGACGATACGATGACGGAGTCGCCGAGCATCTC
CGATCTCTCTATGGACGGCAACTACGAGAAGTCTCCACCTCCTATGTCGAACATGCAGCTGGGCTCGTGTCATGAGGCCT
ACAGCGGCAATGGAAGCTTTGCCGCTGGCCTGAATGACGGCAGCCGGAGCCGGCCGCCGAGACGCGGTGGAAACCGCGAT
GAGTTCGACGGTCCACACCAGCTGCTGCCACGGCCAGCACCCCAGTACATTGCCCAACAAGAACGGGAGCTGCCACACCT
CCCGACACACCTGCATGTCGAGGAACAGGACGCCGTGCTCTCACAGGTCAACGACCGGCTATCGCAGTGTGCCTTTGACT
TTGTCGCTCGATACCAGTTTCCCATCCCGCTGACACAGGACATGCGGCGGGTGTCACGCCCACAGGACCGGGAATGGACT
GAGTGGGTGCAGCTGCTGAAGCGCCTGGCCACCAAGCGGCGCATTCCTGCCCGCGTGCTGTACAACAACCAGATCAAGCA
GTTCGTCACCATCCTGGAGAACTCGCTGGAGATGCGACATGCCGCCCGCCACCAGTCACGTCCGCTCAAGGACGACCGAA
ATATTCTGCAACTGATTTCCGCCGGCATCCAGGTCGCAAAAATACTCAAGGATGCTCCAGCCATGGACTTTCTCGACCGT
CTGTACATTGACACGGAGAAGCAGATACAGGAGCGGAGTGCTGCCGCCACACGGTTCCGCATCTTGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62