GenePrediction:GLEAN_8008 Details

Name: GLEAN_8008
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1670133..1667882 (- strand)
Length: 2252
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1670133..1669048 (- strand)
Length: 1086
Type: CDS
Source: GLEAN
Position: GCSC_113:1668963..1668849 (- strand)
Length: 115
Type: CDS
Source: GLEAN
Position: GCSC_113:1668759..1667882 (- strand)
Length: 878
>GLEAN_8008 class=GenePrediction position=GCSC_113:1670133..1667882 (- strand)
ATGGCAGAATCGAGCACTCTGGCAGCTTCCGCTGCATCCACAAGCTCGACAGCTATAGAGGCTCTCATCGAGGCGCGACC
GCCGGCCACCGACCAGTTCACGTACCTGACTCTCATCCAAGAGAATCTGTCACCCGACGTGTTGCCCACATTACACGAAA
TCCTACAAGATGTCCAGCTGACCCAGGAAATTGGCTGGGACTTGGTGGAGACGTTAGTACCGCTGCTTCCGGGGTCTGAG
TCTTGTCTTGACGATGTCGCCCGGCTGGGCAACCCGAGGGAGGTGATCTTGAAGGTACTGGAAGTCTTGGAAGGGCTCAA
GACAACCCGACTTTGCGGACCTTCCAAAGGCGAAGATAAGAGGGGCGGCGGAGGGGGGGAAGAAGACGAAGACGAGGAAG
AAGAGCTCGCAAATGTCGAAGAGGGGAAGGAGGAAGACCCGCAAACAGCCGAGATGACCACCAGGACTTTTGTTGTGCTG
CTGGGAATGTTGAGCGTCCTTCATCGGCGGATAAAGACAAAATACCCATCCCGCTTCCTCGAGACGACACTGCGGACCAT
CCTAGCTGCCTACCGCCCCGATCAGCTGGCCATGACGACGGCTGTTCTCGGTCTAGTTCGCTCCCTCTCTGCAAACAAAC
GGCCCTTGCCACCACTGCGTCGGTCACAACCACATCTGATGACGCTGGATCTGGCAGCCGGAGGATCCGAATCTTCGAAA
GAAAGCAAAGGGACGAGTACGGACGCAAGCACTTCGATATCAGGTGCGTTGGTGCGACAAATCAGCGCCATCGGCCAGGT
GGCCAGCAACACGGACCAGACGGACGAGTCAGCCGTGTCTATACCTGACCCAGAGGCCGAGGATCTTGTGGACCCGGCAG
AAGGCGCTGTACAGCAACGGCTGCTTCAGTCGTTTTTGACGTGTATACTCGAAGCCTACGTCAACGCCAATGAAATGGCA
TGGGCGCCACGGCTATTCGAACACTATCATCCGAATAAGATTGTGCCGGGTCGTCCGACAGCTCTACAGAGATTCCGCGA
AGACCCGGATCTGGCGGCTCGAGACTCTACGGTTGGAAAGCTTGTGGTGAGTTTCCACGGCGGATTTTCCTGATTAGAAG
GCGATGCCTTGCCCTCTACACGTCAATGTGCCCGCTGACAATGTATATAGGCTCTTGCTCTGGACCTCGGCCTCAAATAC
TCGGATGCATTTGTGCACAGCGTGAGCAATGGGCCAGTGCGACGTAATCCTCTCGCAGCAATTGATATCGCCGCTACTGG
CACTGGTCTTGAGAGCTCTGACGGCATACCCTTGTCAACGGGTGGCACAATTTGCCTCCTGGCGTATTGGGTATTCTCGG
TGGAGGTGTTCAAGGCGGACGCCCCGTTGCCCCGGAGATGCACATATTTCCAGACCACTATGCGATTTTGAAGGCATATC
TTGAAGATGGTGCAGCATCCGAGGTTGGGCGATCACCAGGGACCGTTGAGGCCATTGTGACCTTTGGCATGTGGCTGGAA
CACAGTGGACTGTACTTTGAGTCACCCGCAAGCGCCGAAGCACCTGTGCCAACGCCCTACATGCCTTATCACCATCTGCT
GACGCTCTGCTCCATGCTTCACCCGTCTCTTCCGGTGCGCAATGCGGCCACGTCGTTGGCAGGTGCGGTGTTGCATGCCG
ATCCGGATCCGGAGGACCGTCTGAAGATCCTGCAGGATCTGTTGGAGAATTGCATGTTTGCCTCGCTCAAGGCGTGTGCG
GTGACATGGCTTCGGGAGGAGATCATTGCGGCAGGCAATGGCACCGGAGCTAGAGCACAGAAGGCGACAGCTGCAGCAAC
GAGTACTCCATTTGGCAGCACAGAGGCGGTCGAACAGCTGCAGTACGCCATCTTCCCAGATCTACAGGCGCTGCACCAGA
ACGTAACAGCGAGCACGCCAGAGAACGATGCGCGGGCCGTGTTGCTGGAATACTGGATCCAGAACTCGCCATTTTTGTTG
CAGGCGGCTAATTTTGCGTACTTCCTGTTTCAGTCGGAGCGGTTCCGGGCCACGGTGGTGCCACCGGGAATGGGGCCGGC
CATAGGGCAGCGGTACGTGGAGCCGCTGGTGCAGGCGGCAATGCGACTACGACGGGAGCTGGACGACGGTGGCGGCAAGG
TGGCCGAGACGGCCGAGACGGCTGAGCTGGAACACATTTCCATGGACCTGGAAGTACTGGCTAGCCGGCTGCAGAGCCTG
GAACTTTCCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62