GenePrediction:GLEAN_8009 Details

Name: GLEAN_8009
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1666430..1664796 (- strand)
Length: 1635
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1666430..1666407 (- strand)
Length: 24
Type: CDS
Source: GLEAN
Position: GCSC_113:1666353..1666268 (- strand)
Length: 86
Type: CDS
Source: GLEAN
Position: GCSC_113:1666205..1666046 (- strand)
Length: 160
Type: CDS
Source: GLEAN
Position: GCSC_113:1665964..1665628 (- strand)
Length: 337
Type: CDS
Source: GLEAN
Position: GCSC_113:1665521..1665387 (- strand)
Length: 135
Type: CDS
Source: GLEAN
Position: GCSC_113:1664941..1664796 (- strand)
Length: 146
>GLEAN_8009 class=GenePrediction position=GCSC_113:1666430..1664796 (- strand)
ATGGCCAAGATCGCTATCGTCTTCGTGAGTATTCGCCAGTGTCCTGTAGGAAGCAGACAGCTTGCTAACATGTCCAGTAC
TCTATGTACGGCCATATCCGCAAGATGGCGGAGGCTGAGAAGGCTGGCATTGAGAAGGCTGGCGGCACTGCCGATCTGTT
CCAGTGAGTAGAAGCCAACTCTCCTCCCATCTAAGCTTTTCAATTGCTAACTCATGTGTTTGCAGGATCGAGGAGACCCT
TCCCGCCGATGTGCTTGCGAAGATGCACGCCCCCGGCCAGTCGACCGACATCAAGATACTCTCTGACCCTGACACACTGA
AGGAGTATGACGGCTTCCTGTTTGGTATCCCTACTCGTTTCGGCAACTTCCCTGCCCAGTGGAAGGTGAGCAATGACCCC
AATGGCGACGCTATCGGCAGACAGCATCGTATTTGAAGCTTACCATTTTTCTTCACCCCTCTGTAGACCTTCTGGGACAA
GACTGGCGGTATCTGGGCCACCGGTGGCTACGCTGGCAAGTTTGCTGGCGTGTTTATCAGCACGGGCACTATGGGCGGCG
GCCAGGAGGTCACTGCTCTGAGCACGATCAGCACGCTCACCCACCACGGCATCATCTTCGTGCCGCTCGGCTACAGTACG
GCGTTTGGCCAGCTGGCCAGCATGTCCGAGATCCACGGCGGCTCGCCCTGGGGTGCGGGTACCTTTGCTGGTGGCGACGG
CAGCCGGCAGCCTTCGGCGCTGGAGCTCGAGATCGCGACGACGCAGGGCGAGTCTTTCTACAAGACCGTCGCCAAGTCGA
CCGGTGCGTGATTGATTTGAAGAACGAGATCGATGGCGACATGCCCGCGACAGCAAGCACTTGTGCTCGAGGTGATCGAA
GAGACGGCTAAGACGTGGTATGTCTGTAGGCAAAAGCTCGTCAGTTTCGGCACCGGCGGCGGCGAAGGCTGGTGCAGGTG
TAAACTCGGCTTCAGGACATGATGCAACTGCGGCAAAGGCGGCTGCAGCACCGACGCCGTCGGAGATGAAGAAGAGCACT
GAGGGTCCCTGTGGCTTGCCAGCGAAGTGTGTTGTCATTTGATTCTCAATTTCGTATTATACCAATCAGCGAACAATAAA
CACGAAGTACAAACAAGTCTTTTTCGAGTGGGTTCTTCGCCGGGGTTGCTTGGCTGGCGGTGCGATAGAGCCTAGCAGAC
AGCCGAGGCCGTTTGATATATCCAATTGTTTCATTTCATAAGCATAGGTCAGGCTAGTCGTGTATTCTTAGATATTCTAA
ATCTTGGTCGTCCGCCCAGCCAGCGTTGGACCTCAAAGGTGCAGTAGATGCCTGTTGTGGTTAGTCATCACGTCGAAGGT
GCTGTTTGGCTCGACAGCTAAGTTCCAAACCCCGGCTTCTGCGCCTATCTGGGTCATAAGATACAAAACTGCGCATCGGT
TTTACTGTTACTTCCTATCACCTCACATCTTGCTGATCTCGAATGCAAGGCTGGTGTCTAAATGGTCACGTGCACGTCTT
CTGCATACCCCCAAATCAGGCTGCTCTTTCCAATCTGGCTGCTGCCTTTCTCGTGGCCATGTACAACATTGGGGGCAGAC
AAGGCAAAACTGTGCTGGATGCTGCTGTCGGCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62