GenePrediction:GLEAN_8010 Details

Name: GLEAN_8010
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1661539..1659533 (- strand)
Length: 2007
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1661539..1661470 (- strand)
Length: 70
Type: CDS
Source: GLEAN
Position: GCSC_113:1661409..1659533 (- strand)
Length: 1877
>GLEAN_8010 class=GenePrediction position=GCSC_113:1661539..1659533 (- strand)
ATGTTTGAGAATAAGGGGGAGACGAGTCCACCGGATCGTGGGCGGGTCCCAGCAGCCCTTCAACCTCAGGGTACGTTTTT
ACCCTGTTCTGTGTCTCATAGCTAGTGCTAACTTCCTTTTGCCGGGACAGCTTCAGATCCTCTCGGACCACTCGCCCGAG
TGCGTACCAGCTTCGTTACAGTTGAAAAGGGCGGTCGAGTGGGTCTGCAACGAGACAACAGTACAGATTCCGGCAACTCA
CAAGCCCGTAAACTCAGCGGCGGGAGCGAGGGGGAAACCGTCCTTTCTCAGACAGATGCAACCAGCACTACGGCCGGAGA
CAGTGTCGATTCGCAAGCAAAGCCAGCAGTCGCCCTTTGGCGAGCAAACGTACAGACACCAGATGAACCAATGAAGCCCT
TCCCTCTGAGGACACCTTCGCCAAAAGCAGCCAAAGACTCGCCAGCACCAGTAGTGGCGTCTGATCCACCTCAGGCCTCA
ACTTCGGTATCCGCTTTCGCTCCAGCTATGAAATCTCTTTCGAATACGTCAAAGTATGACGCGCCAAAGCTGTCCTCCGA
GAAGACGGAAAGAGTGGCGAGTAGGGGCAAGTCCCCAGAGAAAATTGCGGGCAAGGCAAGCGAACTGGCTTCTGTGAAGG
CTACCTCGTCTGGCACCAGTTCTGCCGTCAATGTTACAAAATATGCCGGTGCTTCTGCAAAGCAACCCACAGCGGCGACT
CCCGCTTCTGCGAAGACCAAGACGGCCAGCAGCAGCAAAGGCAAGGATGCGTCCAAGCCAGCGGCCACGACTGCCACGTC
TCCCACCAAAGCCAAGGCCACCAAGAGTGTGCCCAAAATCTCTACAGCGGCACACTCAAAGCCGGAAAAGAGGGCTGCGG
CTGCGCCCTTGAAGACACCTACAAGTCCCTCCAAGTCGCTGGCACTCAAGCATCACAAAACTCCTGAGAGAAAGACGCCG
GCCCCGTCAGAGAAGACAACGCCAAAATCTACGACCTCCTCATCAAGCAGGTCTACAGCTTCGTCGTCCTCAAAGAAGCC
CTCGGCTGTCCATAAACTCTCTCCTAATGGTTCGGCTTTTGTCAAGCCGAAACCGAGGTCGCCCACCCGCCCTGTGCAGC
TTCCCGCTGGACTCGTGACACACACAGCAGCCTCGGCTACAAAGGCCAACGTGACTCGCCAGACTCAGTCAAGACAAGCC
GGCAGTTATGACAGCACTCATCAGCCCTCGGCCAGGGCTTCCAGCAGAGCCAGCATTGCAACTGTTGCCACAACGGCCAC
CAAGACAACACAGCGGGGCCTTCGGAGACAAAACTCGACCATCAGTCGGTCTCGGCCCAGTCTCGGCCCCCCTCCGAAGC
AGCCAGCTCGAGACCATTCTGCACTCAAGAAGGAAAAAGATGTTGATGAGAGCTTTTTGGCCCGCATGATGAGACCAACT
CAGTCTTCAGCCTCGAAGACTGCAGACAAGTCTGGCGCCCCCCATACTTCGCCTCCCCGAAAGCAATCGCCAGCTCCCGT
TAAGCGGACTGCCCGCAGTGAGCATAGTCCTGTCTCAAGGAGACCAGAAAGTGCTATGCATGCGATGAGCCTTGCGTCGA
CGCCTCCACCCTCAACACCCACACCTGCAGAATCTGTTTCGGTTACACCAAAATCAACTGGATCCAGAGCCACTTCTAGC
GGGAAGGCGTCCCCTGTTGAAGAGACGTCGCCTATTGAGAAGTCGTCTGTCACCGAGACTGTGAACACGGCAGATGTACC
CAAGGCTGTCGAACAAGCACAGCCGGAGGAAGCAATTCGCGTGGCCACCCCAGAACCAGAATTGGAGCCATTTCCGGAGC
TAGTTCTGGAAGAAGAGGCGGAGCCAGTAGCAGCTGATGCAGTAGCCCAGGAACAAATGACAAAAGTTGTGGGGCTGGCA
CAGCCCGAATCGGATGTCACCCCTGAAGTTAGCACTCCGGAGGAACAAGAAGGTAAAGGCGCCGAAGTAATTGAGGTAAC
GGTATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62