GenePrediction:GLEAN_8011 Details

Name: GLEAN_8011
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1658882..1657967 (- strand)
Length: 916
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1658882..1658875 (- strand)
Length: 8
Type: CDS
Source: GLEAN
Position: GCSC_113:1658805..1658785 (- strand)
Length: 21
Type: CDS
Source: GLEAN
Position: GCSC_113:1658656..1658489 (- strand)
Length: 168
Type: CDS
Source: GLEAN
Position: GCSC_113:1658423..1657967 (- strand)
Length: 457
>GLEAN_8011 class=GenePrediction position=GCSC_113:1658882..1657967 (- strand)
ATGTCTAAGTAAGACAATGATGAGAATACCCTCTACTGATGCATATTGAGCAAGCGGCTAATCGTTCTCTTCTTCAGAAT
CACCGTCGCCGGAGTGCGGTATGCTTTTTCCAACCCCGACCCTTTATCCTCGTCTCGGCGGCCCGCCTCTGTTTCTATGC
AATCTTGGCCTGCTACCGGGACAGAGGCTCTATACTAAGATGGAACGGTACTGACATTACTTCCAGTGGCAATGTTGCCG
AGGTTCTCGAGTACTCGCTCGAGACCAAGAAGAGGAACTTCCTCGAGACGGTCGAGCTCCAGATCGGCCTGAAGAACTAC
GACCCCCAGCGTGACAAGCGTTTCTCTGGTACAGTCCGCCTGCCGTCTGTGCCCCGCCCCAACATGGCGATCTGGTATGT
AGACAGGAAGGGTTGCAGAAACGTAATGGCGTCGGTGGCCGCTAACCAAAGCGTCGCAGCATTCTCGGTGACCAGCACGA
TATCGACCGTGCCAAGCACGGCGGTGTCGACGCCATGTCGTCGGACGACCTGAAGAAGCTCAACAAGAACAAGAAGCTGG
TCAAGAAGCTGGCGCGCAAGTACGATGCGTTCATCGCCTCCGAGACCCTGATCAAGCAGATCCCGCGTATCCTCGGCCCT
GGTCTGTCCAAGGCTGGCAAGTTCCCTACGCCCGTCTCGCACGCCGACGATCTGTCGGCCAAGATCATTGAGGTCAAGTC
GACGATCAAGTTCCAGCTGAAGAAGGTTCTGTGCATGGGTGTCGCTGTCGGCAACGTCGGCATGACCCAGGAGCAGCTGG
TTGCCAACATTATGCTGGCCATTAACTACCTCGTCTCGCTGCTCAAGAAGGGTTGGCAGAACGTTGGAAGCCTGACCATC
AAGGCTTCCATGTCGCCGCCCCGCCGTCTGTACTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62