GenePrediction:GLEAN_8012 Details

Name: GLEAN_8012
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1654807..1653467 (- strand)
Length: 1341
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1654807..1654749 (- strand)
Length: 59
Type: CDS
Source: GLEAN
Position: GCSC_113:1654692..1654527 (- strand)
Length: 166
Type: CDS
Source: GLEAN
Position: GCSC_113:1654453..1653467 (- strand)
Length: 987
>GLEAN_8012 class=GenePrediction position=GCSC_113:1654807..1653467 (- strand)
ATGGTTCCTCCGACAGGACCACTCAACCTCGGCGTGGAGGAGATATCTGGAATTTGCGGGTGTGTAGCATGGTCGCCGGG
ATACAGGCTTGGGCTTCCAGCCGCTAACATGCCAGGTCCATATCCATTGCCTGTTGGGTAGTCGTCTTCTCTCCACAGAT
TATCGAGAATTTCCGTCGCGGAAGTGCCGATGGGCTTTCGCTTCAGTTCATCATTGTCTGGCTGGCAGGTGATGTCTTCA
ATATACTGGGAGCTGTCTTGCAAGGAGTGCTGCCGACAATGGTAAGATCCCTATCAGTCGCCCAAGTCTCGGTCTGATAC
CTCGACTAACCGCTGCCTCTTTTTGCCTTTACAGATCATCCTCGCCATCTACTATACGATTGCCGATATTGTGCTCCTCG
GCCAGTGCTTCTACTACCGCGGGTTCACATGGAGAGACGACGTGGTGCCGCCAAAGGCCAAGACGCGGAAGACCAAGACG
AAGCGCGCAGTTGGAACAACAGCTGCCGGGACAGTCAACGAAAGCATCTTGTCCGAACGGTCAGCCTTGTTATCCCAGGA
TGAAAGCCACCGCAATCATCACCATTCACAAGGGCATGATCACCACGAGCGCCGCCGTTCCAGCTGGTCGGCCCTCTCGC
CCGCCGTCCCTTTTGTGTCCGAACTTGGCTCGTCCGAACACCACACCTCTGCCTCTGTGCCTTCTGCCTCTGCATCTCCG
GCCAGCGCCCGTTCGTCTGCCTCTCGCCTCCAGGCCACCGCCCTCAACTTTCTGGCTATACTCATGGTCTGCGCCGCCGG
TGTGGCTGGCTGGTACTTGAGCGGTGGTGCCCAGGAGAAGAAGAGCCAGCCGCCACCATCGGGCGAGGACGGCAGCGGCG
ACGATCCGCTCGTGTTCAGCGTCTGGGGCCAAATCTTTGGCTACTTCTGCGCGGTGCTGTACCTGGGCTCGCGGCTGCCA
CAGTTGCTGCTGAACTGGCGGCGACAATCGACAGAGGGCGTGAGCATGCTGTTTTTCTTGTTCGCATGCCTCGGCAATCT
GACGTATGTGCTGTCTATCTTCGCGCACGAGGAGCACAGAAACTACCCACCCGGAGAGGCGCGGCGCCGATACGGGCGCT
ACCTGCTTGTCAACCTGTCGTGGCTGGCTGGCAGTCTGGGCACGCTGCTGCTGGACATGGGAATCTTTATCCAGTTTTTC
ATGTACCAGCGGATAGAGGATGACGGCAGCGAGGATGACGGAGACGACGCAACAGAGGTTGCCACCTCCTACAGCGATGA
TGAAGACGACGACGAGACATTTGAGCCCATCCTTCAGCGAAACACATCCTATTATGGTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62