GenePrediction:GLEAN_8013 Details

Name: GLEAN_8013
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1640207..1638900 (- strand)
Length: 1308
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1640207..1640137 (- strand)
Length: 71
Type: CDS
Source: GLEAN
Position: GCSC_113:1640064..1638900 (- strand)
Length: 1165
>GLEAN_8013 class=GenePrediction position=GCSC_113:1640207..1638900 (- strand)
ATGCCGTTCGACCTGCAGACATGTGCACGGCCGAACATCCTGGCGCTTGAGCCGTACCGGTGTGCGCGAGAGTGAGTGCC
CGGGTCCCGTCTCCTCGTCTCCTCGTCTTGCAGCGTATTGGGCCTTGTATTCTGACCGCGCAGCGACTACAAGGACGATG
GGACGAACGTGCTGCTGGACGCCAACGAGAACGCCTACGGGCCGCCGCTGACGGCAGTGAGCGACAGCGGGCTGGCGGCA
TCGGCGGCATCGGCAGGCATCGACCTGCTGGGACTGCACCGGTATCCCGACCCGCACCAAGAGGAGCTGAAGGAGCAGCT
GTGCCGGCTGCGCAACACGCACGCGCACACGGCGCGGACGCTGACGGCGGCGAACTTGTTTGTCGGCGTGGGCAGCGACG
AGGCCATCGACGCGCTGCTGCGCTGCTTCTGCGTGCCGGGCCGCGACCGCATTCTGGTGTGTCCGCCGACGTATGGCATG
TACGCGGTGTCGGCGCAGGTGAATGACGTAGGCCTGGTGCGCGTGCCGCTGACGGCGGCGCCGGCCTTTGACGTCGACGT
GCCGGCAGTGACGGCCGCGCTGACGGCAGCCGTGGCCGCGACCGACTACGATGTCAAGATTGTGTATCTCTGCTCGCCCG
GCAACCCGACGGGCGGCCGGCTGGCCAAGACCGACATCGAGGCCGTGCTGCGCCACCCGACGTGGAATGGCATCGTGGTG
GTCGACGAGGCGTATGTCGACTTTGTGGCCGACGAGCGGACGGCCAGCCTGGCCGAGTGGGTGTGCGACTGGCCCAACCT
CGTCGTGCTGCAGACGCTCTCCAAGGCGTTCGGTATGGCCGGCATCCGTCTCGGCGCTGCCTTTGCTGATCCTGCCGTCG
CCCGTCTACTCAACAGCCTCAAGGCGCCCTACAACGTGGCTAGCCCGACCAGCGCGCTCGCCCGCACCGTCCTCGCACCC
GCCGGTCTCGCTGTCATGCGCGCCAACCGCGCCCGCCTTGTCGCCCAGCGCACCCGCCTCCTCGATGCCCTCCCGCGCAT
CCCCGGTGTCGGTCGTCTGCGCGGCGGCACCGACAGCAACTTTTTGCTGTACGAGATCCTCGACCCCGCTGGCCGCCCCG
ACAACGCCACCGCCCTAGCCGTGTACGAGATGCTGGCTGAGCAGCGCGGCGTCGTCGTACGCTTCCGCGGCAAGGAACAC
GACTGTCTCGGCTGTCTGCGCATCACCGTCGGCACCGAGGCTGAGGTGACCAAGCTGCTGGCCGCCCTGGAGCAGTCGCT
CGTCGAGGTGCGCGGAAAGGCAGTGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62