GenePrediction:GLEAN_8017 Details

Name: GLEAN_8017
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1589339..1586963 (- strand)
Length: 2377
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1589339..1589033 (- strand)
Length: 307
Type: CDS
Source: GLEAN
Position: GCSC_113:1588959..1586963 (- strand)
Length: 1997
>GLEAN_8017 class=GenePrediction position=GCSC_113:1589339..1586963 (- strand)
ATGTCTTCCATTCTCAGCCGCGTGTTCGGTGCTGTCAGTACCTTTACGGGTAAAAACAAGGCGTCTGACTCGGAGTCACA
GGAGAAAGCGGGCCAACCAGAAGCCATGGCAGGTGCCAAAGACAGCGGTCTTGCGACGACCCCCGGCAAGAATCCTAGGA
AGAGACTTTTTGACGATGAGGGCGATGAAGAAGAGGCAGAAGACGTCGGCACTTCCAAGTCGCTCGGAAAGACGTCGTCC
TTCACAATAAACGAGGAGTACGCCCGGCGATTCGAGCACAACAAGAAGCGTGAAGAAATGCACAAGTGTAGGTGCAGTCT
GGGGTGACCTTCCGTGCCCGACTGCAGAGTCCTTGGCTAACAGCTGTCTTCATAATGCAGTGGAAGAAAAGTACGGAAAG
GGAGCTGCGAAATTCGGGGCTGATGACGAGGAGGATGACTCGTCCACGGATGAGTCTGAGGACGAGGACGGCTACCTCCT
GACGGAAGATCTCGACGCACGCATGACGGAGGCGCTCCAGGCGATCAAAAACAAAGACCCCCGTATCTACAACGCCGAGA
CCAAGTTCTTCGACCCGTCCGAGATCGACCAGATGGCGGCAGATGCAGCCAAGGCGGGGCCCTCGGAGTCCAAGCAGAAG
CCCATGTTCCTGCGCGACTACCATCGGGAGCGGTACCTACGCGGCGACATCGGAGCCGAGGACAGGGACGAGGACGAGGA
CGTGGCAGTGGTCAAGGCGGTGCCGAAGACATACCAGCAGGAGCAGGACGAGGTCAAGCAGGCGCTGATCCACGAGATGA
ACGCTGCGGGCGAGGACAGCGACAGCAACGGCGACAAGGCGGCCGGTGCAGGCTCGGATGACGATGTCGACACGTTCATC
AAGCCAAAGGCGTCGTCCAAGGCGGCCAAAGCGGCGTCCCAGGCCAGCGAGAAGATACATCCGTCGCGTGCGGGTCGGGT
GGCCAAGATCAGCGGCGAAGAGATTGCGAACGCGAGCAAGAACCCAGAGCTCTTTCTATCCAACTTTATGGCATCGCGTG
CGTGGGTGCCTGAGGACAAGAGCGAGGGTCCAGGTTGGCGGGCGTTTGAGTCGGACGATGACGAGTCCGAGAATGACCGG
GCCGAGGAGTTTGAGGCGGCCTACAACATGCGGTTCGAGGATCCGGCCAAGAGCAACGAGGTGCTCAAGTCGTATTCGCG
CTCGGTCGTGGCACAGCGATCGGTGCGCCGTGACGAGAAGACAAGCCGCCAGCGACAGCGCGAGCAGGAGAAGGAGCAGG
AGGCGGCCGAGAAGCGGGAGCGCAAGGAAGAGCGGACGCGGCTGCGCAAGCTGCGGCTCGAGGAGGCGCAGGAGAAGCTG
GCCAAGATCAAGCAGGCCGCCGGACTGCGGGGCAAAGAGATGAACGACGACGAGTGGGCCGAGCTGCTGGACGACGCCTG
GGACACGGACCGGTGGGAGGCCAAGATGCGAAGTTACTTTGGCGACACGTACTACTCTCAGCCAGATGCGGGTCTGGAGA
GTGACGATGACGACGATGACCAGGGCAGCGACAGCGAAAAGAAGGCCAAGAAGGCCAAGAAGTCCAAGAGCAAGGTCAAG
AAGCCCCAATGGGACGACGACATTGACATCAACGACATCATTCCCGACTTTGAAGCCACCGAGCCGCAGATCACCCTTTC
GGACGAAGAGGGTGAGGGTCCGGATGAGGCGGCAGACAACGACGACGACAACGACGATGACGACGATGACGACGGCGAAC
AGCCATCGAAGCGCCGCAAGACGACCAAGGATCGCAAGCAGGAGCGTGTCGAGGCGAAGCGCCAGGCACGGCGAGAGCGG
GCGCGTCTCGAGGCGATTGTGGACCGGCAGATGGAGCTGGACGCGCCCACGGCACTGGCCGGCTCTCGCGGTCGTAGCGG
CTTCCGCTACCGCGAGACGAGCCCGCAGTCGTTTGGGCTGACGCCGCGGGACATTCTGTTGGCGCCGTCCGATGCCGCGC
TCAACGATTTTGCCGGCCTCAAGAAGCTAGCGACGTTTCGCGACGAGGAGCGCAAGCGCAAGGACCGCAAGACGCTGGGC
AAGAAGGCCCGTCTTCGCCAGTGGCGGCGCGAGACCTTTGGCCACGACTTTGAGCTGACCGGGCCGACGTATGGCTTTGA
GCGGCTGCTTGGCGACAAGGACGCTTCGGCGTCGGATCACCACCGGCGCAAGAGCAAGTCTGAAAAGACCGAAAAGACCG
AAAAGACCGGAAAGACCGGAAAGACCGGAAACCCCGAGAGCGACAAGCCGGCCAAGAAGCGCAAACGGTCTGGCCGCAAG
GGCAAGGGCACGGAGGCCGAGTCAGAATCGGCCAAGACGGCCGGACAGGAGGCGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62