GenePrediction:GLEAN_8019 Details

Name: GLEAN_8019
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1570971..1569120 (- strand)
Length: 1852
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1570971..1569870 (- strand)
Length: 1102
Type: CDS
Source: GLEAN
Position: GCSC_113:1569796..1569120 (- strand)
Length: 677
>GLEAN_8019 class=GenePrediction position=GCSC_113:1570971..1569120 (- strand)
ATGCCTCTACAACTGCGTTGGCGCTGTCCCTTGGGCGGACGTCCGCTGCGCCTTTGCCACTCGTGCTGTGCGGCTGGCCT
CCTCGGTGCAGCCCCTGGCGCCAGCGCTGAAACAGCTGCCAGCCGGCGCTGTGGCCACTCGCATTCCCGCTTGATCCACC
ACGGCAGCCGCTTCTATTCTTTCCTCCACGTCAGCCAGCAGTCCTTATTCATCAAGCCACCTCTACCGCAAATACGACTG
CAGCAGTCGCCACGACAGTCAACACGTCATCTTCACGCATCCTTGTCGTCGTCGCCCCTGGTATTTAGCTCTCCAACGCC
GTTGCTGCTTTCACCCTCCCTCTCCACTCTCGCGCAACTCCCCTTTTCAACCTCATCGTCCCCGAAGCTGCACCAGTACC
AACACGACCGATTCGACGCGTCGCAGTCCTGGTCGCCACCCTCTCGAAAACACCGCCGCAAGCTCGCCCGCTGGCTGCCC
GCCATCATGGCTGCCTCGCACGTCCGCACGCGCAGTGACGATTCGCACACCGAATCCCATTCCCAAGCCCACAGCCACTC
GCACGGCCTCGGCCTCGGCCATCATCACCATCACCACGACAATGTCTACCTCACGTCGCAAAACAAGAAGGACGCCGGCG
TCCGCATCACGCGCATCGGCCTCTACTCCAATCTCGGCATGGCCTTTGTCAAGGGCGCCGGCGGCTACTTTTTCAACTCG
CAGTCCATGCTGGCTGACGCTTGGCACAGCATGACTGATCTAGCTTCGGATGTCCTCACCCTGGCCACGGTCTCGTGGAG
CCTCCGACCGCCGACCGATCGCTTTCCCACCGGCTTCGGCAAGGTCGAGAGTCTTGGCTCGCTCGGTGTGTCCGGCATGC
TTCTCGGCGCCGGTCTGTTCATGTGCATGAGCAGCTCCCAGTCTCTCTATGCACATCTCTGGCTGGATCCGGCCGCAGCT
GCTGAGGTCCTCGCCCACGCCCATTCCCATGGCCACAGCCACGGCCACGGCCACATGCACAGCGACGGCGGTGGTCCCAG
TCTGCATGCCGCCTGGCTGGCTGCCGGTACGGTCTTGGTCAAGGAATGGCTATATCGAGCGAGTATGCATTAACCCTTTC
TCTCCCTTCCCCCCCACACCTCTACCCCTTTTTCTTGACTTACTGACCCCATCAGCCATGAAAGTTGCCCGTGAACGGAA
ATCGTCTGTGCTTGCCTCGAATGCCGTGCACCACCGCGTCGACAGCCTCACGGGCATTGTAACTCTGGCCGTCATTCTGG
GCGCCAACTTCATCCATGACGCCGCCTGGTTAGACCCGGTCGGTGGGCTGCTGATCTCGCTTATGGTGATTCGTGCTGGC
TGGGAGAACACGGCGTCGGCGCTGTACGAGCTTGCCGACCGTAGCATCGACGAAGACGTCAAGCGGTCGGTACGGAAACA
GATCACCCAGTCGCTAGCAGACCAGACTGCAGTGCCGGACGGCCAGCTGCACTTGGTGGAGGTTCGCGACGTGTCCGGGG
TCAAGTCAGGACCGAACTACCTGGTGGACATTGAGATGGCCGTACCGGGCGATTGGACGGTCGACACAACACGGGCAATT
GAGGAGGCAGTGCGGGCTCAGGTGGGTGGTTCGGTGCGAGGAGTCAGGCGGCTGCGGGTCCGGTTTGTGAAGCTGGATGA
GACCACGGCCAAGTTTGACGACTTCATGGCGAACGGCATCAGCCCCCGTGAGAGCCCGGAGCCGGAAGAGCACGATCATG
ACCACGGTCATGGACACGATGATCACGGCCATGATCACAGCAACGGAGCGGCCAATGGGACGTCAAACGGAAATGGACAC
AAGAAGCATTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62