GenePrediction:GLEAN_801 Details

Name: GLEAN_801
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_132:75646..77766 (+ strand)
Length: 2121
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_132:75646..76959 (+ strand)
Length: 1314
Type: CDS
Source: GLEAN
Position: GCSC_132:77209..77599 (+ strand)
Length: 391
Type: CDS
Source: GLEAN
Position: GCSC_132:77696..77766 (+ strand)
Length: 71
>GLEAN_801 class=GenePrediction position=GCSC_132:75646..77766 (+ strand)
ATGATCGATTCCCCCTTTCCTGTGCTCTGCTGGCAGCCGAGTTCTCTCTCCTGCCGACGAAGCAGCGGCCCGTCAGACAC
AAGGCTGTTGAGATCGTACGAGCAGGCCTTTCTCCTCGACCCTGACCCCTTTGAGCTCGCCATGCCTGCCACCCCGTCGT
GGACTCCGCAGTGGCCTCACGGCCTGACCAAGAACGGCTCCACCTGTCCATGTTGCCAGCCGGGCGTCATGGACCGCAAG
AGCCGGGCGCGGCGCCTGAAAGACCAGGCCCAGCTGGACGCACAATACGAGCATCTCCGCGACCTCTACCCGCGACGCAG
TCCGCCCCTCAACCGCGCCCTGTCATCACCCGATCGGCAGAAACCATCACTTTTCCAGCCAGCTCAGACACGTGCTGATG
CCGTGCCAAGAAATGCTGAGGACGGGCGAGACAGCGAGCAAGACCAGCACGTGGAAAGGAACGCAGACGCTGCGGACGAC
GAAGAAGATGATACAGAAGACGAGCACGGAGATAGTAGCGACGGTAACATGGGAAAAAAAGGAGATGACGACGAGCGAGA
AAATGATAGAGAGAAAGACCGGGACAAGGAAGAGCAGGACCAGCAAAATGCGCAAGATGGGGACGATGAGCAGGAGGAGG
ATGAAGACGAAGAAGACGATGAAGACGACGACGATGAAGATGAAGAAGAAGACGACGGCGATGACGAAGATGAAGAAGGC
GAGGACGACACAGACGTCGAGGGCGTGGTGAAGAAGGAGCCCGAAGAGTTTCGCATCCGCATTGACAGTGCCAATGCAGC
CTTCATGCAACAGCCACCGCCACAGTCAGGCCTGCCATCGTGCAGGGAAGAGGAAGACACCATTGTGGTCAAGCTGGTGC
CCGATAGCATGGACGTCGACTCAGACATGTTTCTCGACGATGACGACGAGTTTGTCCATTTCGACAGTCGCCAACCCACG
AGCCTCATGGCATACGGCCCGATGTCGTCTGCAGCAGCAGCAGCGATGCAGCAACAGCAACAACAGCGGCAGAATCTATG
GCCACATTCACGGCCTCGTCATCGTCCACGGCCTCAACAATTGGCGCCCCAGCCGCGGCCGATCGTCGTGTCGTCCGGTC
TGGCTGAACAAAATGCACATCTGCGGACGCAGCCTCCACGGCTACAGCCTCGTCCGCCAGCGTATCCACCACATCCATCA
CGTCCGACACAGCCTCCGACGCTCTCGCGACTCCGCGTCGACGCACCCGTGTTGGCCGACCCCAGCGATCCTGGCACGGC
CCAGACGCCTGCCGGCATGGAAGCATTCTGGGACGTTGCCCTGCAGCGACTGCGGCTGGAGAAACTGCAACAACAGCAGA
AACTGCTACAAGAACAGCAGCAGCTACAGCTGCAGCAGCTGCCACTGCCCATTCCAGCACCAACACCCCAAAAGGTGCCC
CAACCGTTCTCTCCTCTGCAGCCGGACTGGCAGCTGCCCTGGCCACCCACCACCCAACCCTGTGGCCTCGGTCCGCCCCA
GAGATACTCTGTTCAGCAGCCACTCCAACCAGCTATGCCACAGGTGATTATCTCACCACCCGCGTATCTGGTCGCCTCTG
CTGACGGCACCGTCGTCGAGGCCCGCCAGCTTCGACGGGAGGCCCGCTCACAGGCCATCGAGGCTGCTCGCGATCGGTTG
CGCCGGCTGCGGTCCGGCGAGTCGCCGCTGGCTAGCCGTCGTGGGCCGCTGGCCAGTCGTAGCAGCAGCCTCAGCAGCCT
CAGCAGCCTCAGCAGCAGCAACATCAGCAACACTGCCAACGCCAGAACAGAGGCCAGTGATCAAGCCGACTTACTCGGCG
TTGAGCAGGGCCGCTCTATTCGCAAGCGACCGTGTCCGTGCTGCAACATGTACATTCGCCGGGACAGGAGCATCTTGCCA
GAGGAGGACTATGCGCGTGAGAAGATTCACGGTGGTACGTTTGTCATCTGTTCCATCTCTGCTCGTTCCTTCTTGTCTTG
TATCCCCACACCTTCCCGATGTCATCATTACATAATGACTAACAGTACAGATTACATTCCCATCAGCATCCTTTACGACA
TGCTACCGCGGCCTCCAAATCCATTTGCCGACGACGAGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62