GenePrediction:GLEAN_8020 Details

Name: GLEAN_8020
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1568600..1566211 (- strand)
Length: 2390
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1568600..1568540 (- strand)
Length: 61
Type: CDS
Source: GLEAN
Position: GCSC_113:1568367..1566657 (- strand)
Length: 1711
Type: CDS
Source: GLEAN
Position: GCSC_113:1566454..1566211 (- strand)
Length: 244
>GLEAN_8020 class=GenePrediction position=GCSC_113:1568600..1566211 (- strand)
ATGGCTACATCCGACGGACCTCTGTATCTCGGGCTCGACCTTTCCACACAGCAGCTTAAGGGTACGTTGTCGTTCGTGTT
CTTTGCTGATCACTTTGCTGTTTGCTCTTTCCTCTTCTCTGTCCTTTGCTCTTGCTCTCTTTCCTCCCCTCTTTCTCCCT
GCTCTTTCCGTTCTGCGCTTTTTCTGTCGACCCTTTCCCCTCGACAAGTCTCTTCATGCTCACACATCTACAGCGATCGT
GGTCGCGTCTGACCTCAGCGTCGTCGCCCAGGTCAAAGTCGATTTTGACAAGGACTTTGGCGCCAAGTATGGCCTGACCA
AGGGCGTGCTGACCAACGAGGCCGAAGGCGAGGTGTACGCGCCAGTGGCCCTCTTTCTCGAGGCCATCGACTTGGTGCTA
GCCCGCCTGAAGACGGCCACGGCCAACACATCGGTGGTATCGCGGATCCGCGCCATCAGCGGTTCATGCCAGCAGCACGG
CAGCGTGTACTGGGCAGCGGGTGCAGCAAAGCAACTGGCGGGGCTGGCAGACCGACCGGACACGGCGCTGGCCGAGCAGC
TCACCGAGGCGTTCTCGCGGCCGTGGGCGCCTAACTGGCAGGACCAGAGTACACAGGCCGAGTGCGATGAGTTTGACGGG
CGACTGCCGGGCGGAGCACACGGTCTGGCCTCGGCCACGGGCAGCGCGGCACATCACCGGTTCACAGGTCCGCAGATCAT
GCGGATTCGCCGGCACTGGCCGGACGTTTATGCGGCCACCACCCGTATCTCGCTCGTGTCATCGTTTGTGGCGTCGGTGC
TGATGGGCGCCCTGGCGCCACTGGACGTCAGCGACGTCTGCGGCATGGACCTCTGGGATATGCAGAACCAGGCCTGGTCA
CAGCCGCTGCTAGAGCTCGCCGGTGGTGGCACCAAAGCCGACGGCGAGGGTCTGCGCTCACGGCTTGGCGACGTGCGCAT
TGACGGTGGTGGCAGCATGGGTGCAGTCTCCAGCTACTTTGTGCAGCGCTACGGCCTCCCCGCCGACTGCCAGATCGCCC
CCTTCACCGGCGACAACCCGGCCACCATCCTGGCTCTGCCGCTGCGGCCGCTCGACGCCATCGTCAGCCTCGGAACCTCA
ACAACCTTCCTCATGGTTACGCCGCACTACAAGCCCGATCCGAGCTACCACTTTTTCAACCACCCGACCACGCCCGGCCA
GTACATGTTCATGCTCTGCTACAAGAACGGCGGTCTGGCCCGCGAAAAGGTGCGCGACGCTCTGCCGCCCGCCAAAGACG
ACAGCGATGTGTGGGCTACCTTCAACAAGGCCGTCCTCGACACGCCCGTCCTCGGCAGCGACCCTGACCGCGCCCATTTG
GGCCTCTACTTTTACCTCAACGAGATCGTCCCCAACATCCCTGCTGGCACGTGGCGGTACAGCTGTGGCCGTGCCGATGG
CGGCGACCTGTTGCCGGTGTCTGACCCGAAGGATGTCGGCTGGAGTCCTGTGCAGGACGCTCGCGTCATTGTTGAATCCC
AGGCACTGTCGATGCGGCTGCGGTCGCAGGCACTCGTGCACGATGTCCCGGGCTCGTCCATGGCCACCACTACAGCAGTG
CCGAAGCTGCCAGCGCAACCGCGTCGCATCTACCTCGTCGGCGGCGGCTCGCTCAACCCAGCCATCGCCCGCGTGCTGGG
CGAGGTGCTGGGCGGCACCGAGGGCGTATACCGGCTGGACGTCGGCGGCAATGCGTGTGCGCTGGGTGGCGCGTACAAGG
CGCTGTGGGCGATGGAGCGGGCGGAGAACGAGACGTTTGACGATCTGATCGGCCGGCGCTGGAAGCCCGAAGGCGCCATC
GAGAAGGTCGGCCCGGGTTACTTGGCAGAGCCGTTTGCGCAGTACGGCGACGTCTTGAAGGCGTTTGAGAAGATGGAGCA
GGAGATTCTGCAGCAGCATGCAAAGTAGATCATGGTAGAAGGTAGAAGGTAGTAGGGATACTTGAAATAGATGCCCCTCT
CATTTTGAAGTTGGCGTGCTTCTGACAGAACAAACGCTGTCAGATCGAGTCCGAAGTCATCAATTGTCATTCGCTACCAC
ATAGCAACGGAGCTCTCCCTGCTCGACTGCCTCTGGCCGTTGCAGCCGAGTACTGTCTGCCGGCAGAGTTTCGACTCCGA
AGCACGCCACTCGCCTCTACAATGGCGTGAGCACCAGGGAGTTGTCTGCACAGTGTATGCTGACTAATACGTTCCAGGCC
GGCTTCCGTGGTCTTTGGATCATCCACAACCTACGACGCCTTCGGACATTGGCCAACTCTTCGTGGACGGAAGGTGATAG
CAGAAGACGGGCCACAGCCGATGAAACGCCTGTCTTCAGCCTCCTGCTCCACCTGGCAGCCTCGGCCTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62