GenePrediction:GLEAN_8022 Details

Name: GLEAN_8022
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1562095..1560212 (- strand)
Length: 1884
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1562095..1561799 (- strand)
Length: 297
Type: CDS
Source: GLEAN
Position: GCSC_113:1561737..1561348 (- strand)
Length: 390
Type: CDS
Source: GLEAN
Position: GCSC_113:1561282..1560212 (- strand)
Length: 1071
>GLEAN_8022 class=GenePrediction position=GCSC_113:1562095..1560212 (- strand)
ATGGTTAACATGGACGACAAGCCAAACGGCTCAACAGCCAGTAATGGCAACGGCAACGTTACGACCAATGGCACGACCAA
TGCCACGATCAACGGCACTGCCAACGGCACTGCCAACGGCACGATGACTCCAGAGAACAACAACGAGCAGCAGCAACAGC
AGCATCTGACGCCGAGCTTGTCGGCTCTGTCTTTGTCGGAGATGACGGTGCCATCGTCGCCATCGACGGACGAGCGGGCG
GCGCGGCTGCGCAAGATCGTGCCGGAGGAGTTTATCCTGCCTAACGGGCATCCGGATGTGAGCACTGATCTGATGATGGG
ATGATGGCAAATAGACGCAGCTCTGACACAGCAGCCAGTACCTGCGCCTGATCCTGACGTCGCGGGTGTACGAGGTGTGC
AAGGAGACATCGCTGACGCACGCGGTCAACCTGAGCAACCGACTGGAGTGCAACGTGCTGCTAAAGCGGGAAGATGAGCA
GCCGGTGTTTAGTTTCAAGCTGCGTGGCGCCTACAACAAGATGGCCCACCTGGACCCAGCCGAGGCGTGGCGCGGGGTGG
TGTGCTGCTCAGCGGGCAACCACGCGCAGGGGGTAGCATACTCAGGACGCAAGCTGAAGATCCCGGCGACGATTGTGATG
CCCGAGGGCACGCCGAGCATCAAGCACCTGAACGTGTCACGGATGGGCGGCAACGTGGTGCTGCACGGGGCAGACTTTGA
CGCGGCCAAAGAGGAGTGTCTGCGGCGGGTGAGACAGGACGGGCTGATCGACATCCCGCCATTCGACGACCCGTTACCGT
GATTGCCGGCCAGGGCACGATCGGGCTGGAGCTGCTGCGCCAGACGAACATCCAGCGGCTGGAGGCGGTGTTCTGCTGCG
TCGGTGGCGGCGGTCTGATTGCGGGCGTGGGCGTGTACATCAAGCGGATCGCACCGCACGTCAAGGTGATCGGTGTGGAG
GCGGCCGATGCGAGCGGGATGGCACAGTCGCTGGCTGCTGGTCACCGGGTGATCCTGAGCGAGGTCGGCCTGTTTGCCGA
CGGGGCCGCAGTCAAGGCCGTGGGCGAGGAAACGTTCCGGATCTGCTCCGAGGTGGTGGACGAGATCATCCAGGTGTCGA
CAGACGAGACGTGCGCGGCCATCAAGGACGTGTTTGAGGACACGCGGTCGATCGTGGAGCCAGCCGGCGCGCTGGCGCTC
GCAGGCCTGAAAAAGTACGTGGCCCAGCACCCGTCAGCCGATGGACGGCGCTCGCTCGTGGCCGTGACCAGCGGCGCCAA
CATGAACTTTGACCGGCTGCGCTTCATCGCCGAGCGTGCAACCCTGGGCGAGGGCAAGGAGGCGCTGCTGGCGGTGCGCA
TTCCCGAACGGCCAGGCTCGTTTGCCGAGCTGATCGATGCCATCATGCCGCATGCCGTGACCGAGTTCAGCTACCGGTAT
GCGTCACCGGCCGAGGCCAACGTGCTGCTGGGCCTCTCGCTCACGGCCCCGGCATCACAGCGCAGCCGTGAGCTCGTCAG
CCTGCTCGGCCGCATCACCGAAGCCGGCATGCAGCCTACTGACGTATCTGGCGATGAACTTGCCAAGAGTCACGTGCGCT
ATCTTGTGGGCGGCCGTTCCGCCGTTGCCGACGAGCGCCTCTACATGTTCAACTTTCCCGAGCGCCCCGGCGCCCTCAAC
GCCTTTCTCGCCACGCTTCGGCCCCGCTACAACATCAGCCTGTTCCAGTACCGCAACGAGGGCAGCGACATCGGCAAGGT
CCTCACCGGCATCCTCTGTCCGGCCGCCGAGGTCGCCGAGCTCGAGATCTACCTCCGCCAGATCGGCTATCCCTGGGTCG
ACTGCACCGAGAGCGCCATGTTCAAGACGTTCTTGCGGACGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62