GenePrediction:GLEAN_8026 Details

Name: GLEAN_8026
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1538718..1532419 (- strand)
Length: 6300
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1538718..1538074 (- strand)
Length: 645
Type: CDS
Source: GLEAN
Position: GCSC_113:1537989..1532419 (- strand)
Length: 5571
>GLEAN_8026 class=GenePrediction position=GCSC_113:1538718..1532419 (- strand)
ATGTCGCGCAACGGATTCGCAATGGCGCCACGCAAGGCTGCGCGCTGGACGTCGCATCTGCGTCATTTTAGCCGAGCAAC
CTCAGAGACGCTCCCGGAAGAGGAGGCCCTTCCCGGCGAGATGGGCCCCAGCAGCCCGTATTCGGGTGCGCCCCAGTCAG
CCCTGTCGCCTCAGCGTCCGCGGTCGCCCGATTCGGTGTCCAGCAGTGCTACGATTCGAGATCCCTTCTCTTCGGCCAAA
CAGACGCCCAAGTTTGAGCGCATATGCACAGTCACGGTAAATGAGGCCTTTACCCGGGAGGAGGTGATGGTTAACCTCGA
CCATTTCGACGACAGCGTCCAGCCGGGCCAGCTGATGGCCATTGACGTGCTTCCAGACCAACGACCGAACTTTGGAAGCT
ACCGACGGACGGCCGTGCGAAAGGACGAGCACGCCTCGTCTCCGGCTGACGCTGCAGACGCGGCCACAACACCGTCTGCC
ACGACGGCTGACGGGGCCGCGTCCCAGCCGGAGCTGAACACGCAACGCCGATATCTGTTTATCGTTAAGGACATGGACAT
GAGGCTCAAGTTGCGCCACCCTTCGGTGGAGATATATGTGGCCAAGCACATTGCTGATGCCTTTGGCATGAAGAAGAACT
CGTCGGTGCTTCTGACAAGGGCAAGTGTCGTGATTCCGTCTGCTGCACATCTGCGTTCCTGGTTCTAACAGCTCCATGTC
CAACGACAGGTCGATGCAAGCAACCCTGCCATTGAGGCGTCCCATGCCGAGCTCGTCTTCAAGGACCAGTATCTCTCCCG
GGCGGATATGTGGCGTCTTGCCGTCGCAGAGCTCTCGGAGCGGACCATTTACAGCGGTCAACGTGTGCTTTTTATGAGCA
CGATCAAGGCGACGGTCACAAACGTCTACGTCGAGGGCCGGAGGACCCAGTCTGCCTTTTTCGGCAAGAACACACGCCCC
ATCTTCCGCAGCGAGTCTGCACGCTATGTTCTCTTCATACAGATGGCCCGAGAAATGTGGGACTTTGACTCGGACGGCTC
TGGCGAGATCATGTTCAGCAAGGTCGTCAACGTCTTTCTCCCAACCCTGTTCAAGACATGGGCAGCCAAGCTGGTGAAGC
ACCTCGTGACCATTGTCCTGTTTGCCCGAGTTGAGTACGATGCCGGCCTGTCCTTTGATCTATCCGAGACGTCTGTTCGG
CACGACTACTACACGGGCGTTCAGTCATCCGGCAATCGACGTCCGTACAAGGATTTTTACCGGGTGGTTGTCAGCGAGAT
GGCCAGCGGAGAATGGACAAGAATTCTGCACCAGCTGAAGCGCGAATTTAACATGTTCCGTCGTGATATCAGCCTTCACC
ATCTGACCCATCTTCGGCCAGATACAGCTGCCTCTATGGCGGACGACACGACGAAGAAGCCCTCGACGGCGAAGCAGCAG
CAGCAGCACATCCAGGCCGAGTCTACGCCGGCAATGTACGGCAACGTGCTCGAGGCCATCCACATGGCCACAACTCTCTA
TGCCTACGACTATGTGGACCGCGATCTGACGCGCACTGGCATCTCGGTCGCCATCATCACGCCTGGATCGGGCGTGTTCG
AGGTCGACTACGACGCCATGCGCCGGACAACGGAGGCCGTGATTGGAAACGGCATCGGCATCGATCTGATTTGTCTGCCG
AAAATGCCTCTGCATTGCGCTCCACTCTTTCGCTTCCGACACCCACGCTACCTGGAGAGGGGCATGGGCAAGACGAGGGC
CTTTTCCAGCCATAGCCAAAACCACGACAGGAGTCCTGGGATCAGTGGAAGCACCCCGAAGCAGTCTGCCGCGCTCTTTG
GAAGCTACTCTAGCATCGGTGGCAGCTCGCTGTCTCCGAGCAAGGCAACAGATGCAACCGTGCGGGGCTACGAGCCCGTG
CAGTCAGACAGATTCAGCGATACCTGGTCCTATGCCTTTCCACAATGGCTGCACGTGTCGTATCTGGCCAGCGAGCCGGG
CGAGATGCTGATGCGTCAGGGCGTGCCACCGCCGCCGATTGTTAACTATGATATCTGTGCAAACGGGAGGACTTACGAGA
AAGAGTTCAGAGTTCGTTGCCGGATGTACGATCTGCAGATGCGAGGCGTTCTCGAGACGAACGAGATCGAGACTGCGCCG
TTGCATTCGGATGTGCTCTTTCCACGCAGCGCATTTCGTCCTTCGGCCGGGTCTCCCAAAGGACTGGCCGTCGAACGTGA
CGGCATTCTGCATGTCCGGAACAAGGTGCCTGCGAATGTGTTGTACGATCAGGTCTTTGGGTTTCAGAGATTCTCGGCAG
ACAAGATTGCGAGGCAAGACGCAAAGTCGTTGTGGAAGCAGCTACAGGACTACGACGGGACACGCCAGAAGCTGCCGACG
ACACGGCGCACTGCCGGTCAAGCCCCGGTGTCAAGCGGCAGGAGGGAGCTGGTGGACACAACCTCTGCATCGTCGACGAC
ATTGAGGACTGCGTTGAAGAAGCAGCAGCTGTTGTCTGACGCGGATGCCACGGCCCACGATAATCGTGAACTCTCGATGA
AGGGTGCTCGTAGCAACAGGCTCCGGACCGTGTCGTCTGCAGATCCGACAGGCCTGGGAACGGAAAGGAAAGCGCACAGC
ACAAGAACGCAACCGGGCACTGGAAGGGACAGCGTAAGCTCGCAGTCTTCGGCCAAGATGCCCAAGGCCATGCGTCAGAT
CAGCTTGGGCCAGAGAGGATTCGGGGTGGCCGCACCGAAAGCAGCGGTTGCGGAAATCAGCGTGGAGACCGTGGCTGCAG
CTGTTGCCCACCTGGCACCGCCATCGATCAAGGTCCCCCCGGCCATGGGGATGCCAAAGGCACTGGCAATCACGGCCGTT
CCGGGCAGCTCGTTTGCGGGTGGATCCGGGTTCCCGAAAACGGACAGTACGATTCCTGGCTCTCTGCAGAGGTCGGCGTC
GGGGATCAGCATAGCGGCCTGGGGCGGATCCAACGGCGGCAGCAGGGCGTTTCAAGGGGTGGCCAGTCAGCCGATTGTGA
TCCGGAGTGGCCAAGGACCTGCCGATGCGGCGGTGCAGCGAGTTGCCGGCTCTCCGCTCTCGACGACGATGATAGGACGT
GGCGTCGCGATGCCGGGCCAGGATCGAGACGTGAGTTATTCCAACGCGCTTCGGGCGGAAGACGATGTGCGTCTGTACAA
TTCGAAGCTCCTTGCCGAGGCGGTGCCGGAGGTGACCAAGATCCTGTCGCCGACAGAGGCGCTGATGCCGTGGCTCGCGA
TGATCAACCCGTCGAAGCCGGAGGCGAACCGGATCGATCTGGCGTCGTTCAACAGCCGGTGGCAGCACGTATTTCCGCGG
CCCGGAGAGCAGCGAGCGATGAAGTGGAAGACGCTCTGTGCGCCAGCAGCGGTGCCGCTGACGACGGAGTCGTTCCCGTC
CAAGGAGCAGCTCCAGAGCGAATACCAGCGGCAGCCGTACAGCGTCTCGATGGAGGCAGACGACGACATGCTGTCGGAAG
AGCCGGCGACGAACGAGGATCTGCTGCGAGAACTGATCAGCCGGCGATTTGCACAGGGCTTCCAGGTGGTGATCGGGCCG
GCGGTGGCCAAGGCTTTTGGGGTGAAGCAGCTGAAGATTGCCGACATCTTCTGTCCGGGACGCTTCATCGAAGATGGAGA
GAGCATCTTCATGTGCATGGGCAACACGATACACCAGCTGTCCTGCACCAAGGCAGCCGGGGTCGAGGTCAACATCTTCC
AGCGGAAGACAGCAGAGCTGGGCAGCAGCGGCGGCACAATGTCGATTTATCGGCCGGCAATCCGCACGCTCCTGGACCAC
GACTACGAGACCAGCGAGATCGATCTGGTTCCGCAGCAGGCGGAGCGCAACTGGAACTACATCGATTCGTATCTGGCCGG
CCACGACGAGCAGCTGAAGGAGAACCTCCGGTTCTGGCGGGCGCGGTTTGTGCTGATACCGATGTCGGCCAAGTCAGCCA
CAGCGACGGCCGGAGACAGCGAGGAAGAGCTGCGGCTGGAAGGCATACGGCGACTCGGGCAGCTCTGGCAGAAGCACCGG
GTGGTGCCGGCGTCGGAGCGGCGGTTCCAGCACGTCGGACATGGGCGCAAGGGTACCAATCCGCTCGACGTGGTGTACAA
GACGGAGGATCCGTCCCTGGTGATTGCAGCCGAGCTCGAGACGCTGCCGCTCTTCGAGGGGCTCGATCCGGGCAACCGCA
AGGGACAGCTGGTGACGAGCAGAGAGCAGTTCCGCAAGGGCAGCGTGAACCTGGCTGCGCTGGCCGAGGCGATCCAACAG
CCGGTAGAAGCCGGGGGCATCCGGATGCAGAACCGGCGCTGGCATCTGCGGCTGCACCACAACTGTTTTATCGGCTCGGA
CATGACGAGCTGGCTGCTGGACAACTTTGAGGACCTGGAGAGCCGCGAAGAGGCCGAGGAGCTAGGCAACATGCTGATGA
TCTCAGACGAGGTCAACCTGGCCAGCGGCAAGGGACGGGACAAGGAAACGGAGGAGTCCGGTCCGGTGTCTGAAGGCAGC
ACAGAAAACAGCGGCAGTGGCGGTGACTTGGGAGCCGGTGCAGGAGAAGGAGGATCTAGCAAAGACAGCAAACGCGGACA
GGGCATATTTGTGCACGTGGAAAGACGGCATCCGTTCCGCGACGGACAGTACTTTTACCAGATCGGAGGCGAGTTTGCGA
AGCCCCATCTGGGCAGCTGGTTCAACGCCCGAAGGCGAGAGGTGTCGGCTCCGTCGACACCGATGACGACAGAGCACACA
AGCCAGCGCGAAGCGACACGGGCGGCGATGCCGTGGCCAGTGGCAGCACACGAAGACACAGTGCCGACGTCGGGGGCGTC
AACGCCGACAGTGCCGGTGCCGTCGGGCAAGAAGCCGCGGGTGGTGCTCAGCAAGGTGATCAAGTACGACGTGGACCACC
GTCGACGATCATACCGACCGGAGCGGATAGACCTGCACTACGACCGGCTGCACAACCCAGACAACTGTTACCACATCCGG
CTGGAGTGGATGAACGTGACGGCGAAGCTGATCGAAGACGTGATCGAGTCGTGGACGCGGGAGGCGCTGCAGTTTGGGCT
GCGACTGGTCGAGGTGCCGATCCACGAGGGCAGTCTGATCAGCGAGCGGAATCCGTTCCGGCGGCCGTATAAAGTGCGAC
TGGCGCGGCAGCCGCCCATGGCACAGCCGTCGACGTACTTTGACCCCAATTCGCTGGCACCACGGCAGCTGCCAGGACGG
CACTTTTACCAGAAGGCGATCCTGCGCAGGTTTGGTTTTGTGCTCGACACCGAGGCGGCATCCAACTTTCCGGCCAACGT
GGACGTGAGCTACTCCTGGGGCCGGCCGGACTACAAGTACACGCAGTACATTCACCGATCGGGCGTGGTCCTGGCCGAGA
TCACGACGGACGGCAACTTTCTGGTGCTGGCCAACCGGCTGTACAGCAGCCGGACGACGGTACGGGAGAGCAGTGCGCGC
AGCAGCGAGCCACAGCCACAGGCGCCATCGCAACCGCAGGCACCACAGGGCGCATCGTTTGGAAAGGCCGAGGCAACGCC
GCTGCAGTCGCCGATGCTCAAGTCTACCCGGGTTGGCTCGCCCCGGATGCGGGCTGCGGGCACAGAGACAAAGGCAGGCT
CAGGCTCAGGCTCAGGCTCAGGATCGGGCATCGGGATCGGGATCGGACTGCTGCACAAGGCCAGCGCAGCCACAGGAGCA
GTCGGCACGGCCGGGCTGTCAGCAGCAGCAGCCGCCGCCGCAGCCGCCGCAGCAACGACACAGTACGTGGTCGAGCCAGA
GGCGATCATGGAAGAGCTCGAGACATTCTGCTCAGACGAGGCTGCGCTCGAGATGTTCTACCGGGAGACGCTGCTGGAGA
GGCAGACCGGGTCGATCACAGCAACGCCAGTCGTTGGCCCGCTGACAGCAGCCGCAGCTGCAGCCGCAGCAGCTGTGCCA
GACACGAGCATTCCCGCATTGGGGCTGCCACCAGGAATTCTCAGCAGCAGCAGCAGCATAATGGGAGGAGGCGGCGCGGA
TGACGATAACGGCAACGGCAACGGCAACGGCAATGGCAATGGCAACAACCACTTTGGCAGCCTCCTGCGCAACGCCAACT
TCCGGTTAGATCTGGCGGCGATCGACTCGGGCACTTCTAGTCCTAGTCCGCGCACGACAAGCCCTGCCTTCCTGTCATCG
CGCTTGCTGTTCCGACGTGGCAGTGTGGACGACTACGGACGACAGCAGCCGCAGGAATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62