GenePrediction:GLEAN_8027 Details

Name: GLEAN_8027
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1530034..1528272 (- strand)
Length: 1763
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1530034..1528342 (- strand)
Length: 1693
Type: CDS
Source: GLEAN
Position: GCSC_113:1528285..1528272 (- strand)
Length: 14
>GLEAN_8027 class=GenePrediction position=GCSC_113:1530034..1528272 (- strand)
ATGCCTTTCGCAGTCAACAACTTCCGCATCAAGAGAGAGGCTCACAGCCTCGGCCGCCAGACAAGCAATGCGCCATTCAA
CCCCTTTTCGCGCCGCGCCTGGTCCTCGGCCCAGGCCCGGAGAAACACCTTCCCGGCAACGGGACCGTCTGACGATCCCG
AGGCCTGCATCGGAAGCGATGACGGCATAGTGACCGATCGCGCCTTTGGCAACCCCATAGGTCACGTCCACACAGCACCC
GCGACTTCGCAAAGCGAGGCCACCGCCTTCGACAGTGGGCCGTACACCGGACAGTATGGCGAGGACGCGACCGCGTTTCT
CGGGCCCCAAAACGTGAATGCTCCCGGGCCGGATGGCAATGGTCTGAAGAAGCGGAAGACCAACGGACTTTCTCCTACCA
ACGAAGATGCGGAGGAAGTGCAGGTGAAAGATAAGACCCACCGGATGTACAAGGACGTGCAGCCGAAGGAGCCGTTCACA
GTCGCCAACCAGCTACAGCGAGTCTTTCTGGGCTCGTTTATCAACATTCTCCTCCTGGCCGCGCCCGTCGGCATTGCGCT
GCACTTTACGAGCGTCGACCCTATTGCCATCTTTGTCGTCAACTTCATCGCTATCATCCCGCTAGCCGCCATGCTGAGCT
TTGCGACCGAGGAAATCGCGCTGCGCACCGGCGAAACCCTCGGCGGTCTGCTGAACGCCACCTTTGGCAACGCAGTCGAA
CTGATTGTCGCCGTCATGGCTCTGATCAAGAAGGAGGTTGTCATTGTGCAGACGTCGCTGATTGGCAGCATCCTGTCGAA
CCTGCTGCTTGTCATGGGCATGTGCTTTTTCTTCGGTGGTCTGCGCCGTCAGGAGCAGTATTTCAACACCACCGTCGCCC
AGACTGCCGCCAGTCTGCTCGCACTGGCCGTTTCTGGTGTCATTGTGCCTACCGTCTTCGATGCTGCCAGCATCACGTCA
CAGAGCGACGTGGCCATGCTGTCCCGCGGCACGGCCATCATCCTGCTGGTTGTCTACGCAGCCTACCTCTTCTTCCAGCT
GAAGACCCACCATGCTGTTTTCAGCGAGGAGAGCAAGAAGGTGCCTGCCAAGCCCTTTAAGCATCACGTCCAGCCAGGCG
CCGTTCGCAGCGCCCTCGTCAACCCTGCCGGGCTCGCTATGGGCAACATGGAGGAGGAGCGGCTGCGTGTTTCAGAGAAG
ATTGCAAACGGCCCCGACGATGATGAGCCCGAGGACCCGCAGCTGCACATGATTGTGGCTATGGCCGTGCTGGCTGGATC
TACCGTCATCATTGCTCTCTGCGCCGAATTCCTCGTCGACAGCATCGACTACGTCACGTCTACCGGCGGCATGAGCAAAG
AGTTCCTTGGCTTGATTCTGCTTCCCATTGTCGGAAACGCAGCTGAGCACGCGACGGCTGTCACGGTGGCCATCAAGGAC
AAGATGGACCTCGCAATCGGTGTGGCTGTTGGCTCCAGCATGCAGGTCGCTCTCTTCCTGATTCCCCTTCTGGTCGTTAT
CGGATGGGGCATGGGCATGGACGATATGTCGCTCAGCTTCGACATCTTCCAGGTGGCTGTCATGTTCGTGGCCGTCCTTC
TGGTCAACTATCTCATTGCCGACGGCAAGAGCCACTGGCTGGAGGGCATGCTGTTGATGTGCCTCTACTGCATTATCGCA
ACCTGTTCATGGTGTAGGTCTTTTCTCTGTCGTTTCTCATCCACATTGCCGCTGACTCGTTTTCTCCAGGGTACCCGGCA
TAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62