GenePrediction:GLEAN_8028 Details

Name: GLEAN_8028
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1525560..1523509 (- strand)
Length: 2052
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1525560..1525111 (- strand)
Length: 450
Type: CDS
Source: GLEAN
Position: GCSC_113:1525047..1523509 (- strand)
Length: 1539
>GLEAN_8028 class=GenePrediction position=GCSC_113:1525560..1523509 (- strand)
ATGGCCGATATAATCCGAGACACGGCCGTCGGCGCCGTGATCCGTTTTGTCACACGGAAGCGACTGCTGCAATATCCAGA
GGAACGGGCAGACTTTGAGCTGCCAGAAGTGTGGCAGCGGATGCTCAACGGAGAGGACGTGCCACAGAAGGACGACGACA
CGGCGGTAGAGGAGAAGACGATGCAGGACGGAAGGCCTGGCTCGTCGACATCTTTGTCGTCGGCATCCTTTGTCAAAGAC
ATCGAGAATCGGGCTACCGGATCGGACTCGGCAGCAGAGAAGAGAGAGGAGAGAGCAGGGCGGCAGTCGATGGCCGATGA
GGAGCCGTATGCGGCACTTCGACAGGCACCTACAGCTCGGTCGGGGACACATGTGGTAGGCGGCACGGCATTGCTACAAC
ACAGCAAGTCGCGCGAGGAGACGCTGCCGTTCACGGAAGAGCGGCTGGAGGTGGAATAGGCGGCAGAACTGGCACGGACA
CGGTCAGAGCCGGTGGTGCCGCGACGAACAAAGACCAAGGACGGGCGGACATTGGCCATTGTGGTGGACTGGTATGCCAG
CGACGACAAGGCGAACCCGCAGAACTGGAGTCGACGGCGACGATACGGCGTGACGCTTTTGATCAGCATCTACACCTTTG
CCGTATACACGTCGTCGGCCATCTACACGACGTCGGAGGAGGGCGTGATGGCATCGTTTGGCGTCGACGCAACACATGCA
GCCCTGGGCCTGGCCCTGTTTGTGTTGGGCTACGGCACAGGACCATTGCTGTCTAGTCCACTGTCGGAGATCGCATCCAT
CGGCCGCAATCCGGTCTACGCCGTGACGATGATCCTGTACGTGATCGTGTCGCTGCCGACGGCGCTGGCCTACGGAAACC
GCGACCACGGCCATGCCAGCACCGGCACCTTTTCCGGGCTGCTGGCCCTTCGTTTCCTGCAGGGCTTCTTCGGCTCGCCG
TGTCTGGCTTCGCGTGCCGCCTCGCTCGGCGACATGTACTCGCTGCTCAACCTGCCGTTCGGCCTCGTGGCCTGGGTCTC
GGCCGCCTTCTGTGGTCCTGCTCTCGGTCCTCTGCTGTCTGGCTACAGCGTTCCGGCCAAGGGTTGGCGCTGGTCGCTGC
TCGAGATCCTCTGGGCAGCTGCGCCCGTCTGTGTGGCTATGCTCATCCTGCTGCCCGAGACGAGCGCGGAGACGATCTTG
CTGCGCCGCACTGAGCGTCTGCGCCGTCTCACCGGCTCCGACCGCTTCCAGGCGCCGTCTGAGGCTCGTCAGTATGCCAC
CGAGGACGCGGCGGCAGCTGCAGCTGTTCTCGCCGGCAAGCCACCACCACCTCCGATCAGCCGCGCCGCTCGCAGCCGCG
CCATTCTCATCGACGCCCTCATCAAGCCGCTCGAGATCACGCTCAAGGATCCCGCCATCCTCTTCGTCCAGGTCTACTCG
GCCATCATCTACGGCATCTACTACTCCTTCTTCGAGGCCTTTCCGCTCGTCTATCCTCTGCGCTACGGCATGACGGCAGG
TCAGGTTGGCCTCGTCTTCCTCTGTGTCCTCGTCGCTTGTATCGTCGGCGTCGCCATCTACTGCTGCTACCTGGCCTTGT
ATCTCAACCCACGCATCCGGGCCTCTGGCAAATTTCCACCTCCAGAAGATCGCCTCATTCCGGCTCTGATTGCCGCCTTT
GGCCCGACCATGGGCCTCTTCATCGTCGCCGGGACCGCCAACGATGCTCCCCATACGCCCTGGATTGCGCCGACGATTGG
CATCACCCTGTACGGCGCGTCCGTCTTTGTCGTCATGCAGTGCATCTTCGTCTACGTCCCGCTCAGCTATCCGCAGTACG
CTGCCAGTCTTTTTGCCGGCAACGACTTTTTCCGCTCCGCCTTTGCCTTTGGATCCATCCTCTTTGGCCGTCCGCTGTAC
ATCAACCTCGGCATCGGTCGTGGCTCCTCCTTGCTGGGCGGTCTGTCCACGATTGGCATCATCGGCATCTGGCTGCTGTA
CTTTTACGGCGCCCGTCTGCACGCGCTCAGCAAGTTTGCTGTCGTGTACTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62