GenePrediction:GLEAN_8029 Details

Name: GLEAN_8029
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1516346..1514991 (- strand)
Length: 1356
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1516346..1516107 (- strand)
Length: 240
Type: CDS
Source: GLEAN
Position: GCSC_113:1516043..1514991 (- strand)
Length: 1053
>GLEAN_8029 class=GenePrediction position=GCSC_113:1516346..1514991 (- strand)
ATGGCATTGCGGCAACCAGTGCGCCACCTGCAGCGCAGCGCGCGAGCTATACATACAGCAGGAGCAGCGACAGTGACGCC
GGCTCTCCGGCCAGCTCGCCGAAGCCTAGCGACGGCAGCACCAGCGCCGCCAGTAACACAAAATGCGCACGGTTCCAAGG
GTCCGACGGCGATGGTCTTCCTCAACATGGGCGGGCCATCGACGGTCGGAGAAGTCGGCAACTTTCTCAGCCGGTTATTT
GTGCGTTCCATCTTCGTTTCTCTCTCTCTCTCTCCTGTGGCTACTGACGGAATTCTCATGTAGGCCGACGGCGATCTGAT
CCCGCTTGGCCGGCTGCAGCGCTACATCGGGCCGCTGATCTCGAGGCGGCGGACGCCCAAGATCGAGAAGCAGTATGCGG
CCATCGGCGGTGGCTCGCCGATCCGCAAGTGGTCGGAGTACCAGAACGCGGAGATGTGCAAGGTGCTGGACGTGATCTCG
CCCGAGACGGCACCGCACAAGCCGTACGTGGCGTTCCGCTACGCCGACCCGCTGACAGAGGACACGTACCAGCAGATGCT
GGCGGACGGCTTTGGCGGCGGACGCGGCGGGCGGGCGGTCGCCTTCACGCAGTACCCGCAGTACTCGTGCTCGACGACGG
GCAGCAGCCTGAACGAGCTGTGGAAGTGGCGGCAGCGGATCGAGGGCAAGAAGGGGCCCGCGGGCGAGAGCGTGGGCGAG
GGCGCCGTGGCCGACGGGTCGATCGCCTGGAGCGTCATCGACCGGTGGCCGGTGCATCCGGGTCTCGTCAACGCGTTTGC
GGAGAACATCGAGGCCAAGCTGGCCGAGTACCCGGCAGAGCGGCGCGACAAGGTGGTGCTGCTCTTCTCGGCGCACAGTC
TGCCGATGACGGTGGTGAACCGGGGTGACCCCTATCCGGCCGAGGTGGCGGCGACGGTGTACGCGGTCAACCAGCGGCTC
AAGTTTTCGAACCCGTACCGGCTGTGCTGGCAGTCGCAGGTCGGACCGCAGCCGTGGCTGGGCCCGCAGACGCAGTCGAC
GGTGAACGAGTATATCGCCCAGGGACAGACGGACCTGGTGCTGATCCCGATCGCCTTCACGTCGGACCACATCGAGACGC
TCTACGAGCTGGACGAGGAGGTGATTGGCGAGTGCGGCCACGCTGACACGGTCAAGCGGGCGGAGAGCCTCAACGGCAGC
CCGACGTTCATCCGGGCGCTCGCCGACATTGCCAAGGACCACCTGCAGAGCGGCATCGGCTGCTCGTCGCAGATGGGGCT
GCGGTGTCCAGGCTGCAAGAGCGACCGCTGTCTGGAATCGAAGCGGTTCTTTGCAGCCCAGGGGGGCAGGATTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62