GenePrediction:GLEAN_8030 Details

Name: GLEAN_8030
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1508499..1503835 (- strand)
Length: 4665
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1508499..1507118 (- strand)
Length: 1382
Type: CDS
Source: GLEAN
Position: GCSC_113:1507060..1506817 (- strand)
Length: 244
Type: CDS
Source: GLEAN
Position: GCSC_113:1506767..1505555 (- strand)
Length: 1213
Type: CDS
Source: GLEAN
Position: GCSC_113:1505490..1504862 (- strand)
Length: 629
Type: CDS
Source: GLEAN
Position: GCSC_113:1504807..1504344 (- strand)
Length: 464
Type: CDS
Source: GLEAN
Position: GCSC_113:1504282..1503835 (- strand)
Length: 448
>GLEAN_8030 class=GenePrediction position=GCSC_113:1508499..1503835 (- strand)
ATGGAGACCGACTCGAAATCTGTCGAGTCCGGGGAGACCGCAGCGATGCCGGGCCAGCAGCAGATCTCGAGCAACGCCCA
GGGCCTGATCCACGCCTACAGCATGGAGCTGGTGCGGTCGAGCTCGCGGGCCACCGGCGGCGGCGGTGCACCGGGACGGA
ACCCGTTCACCGGCACGAGCAACGACCCGGCACTCGACCCACACTCCAAGGCCTTTGACGCCCGGCGATGGGCCCAGGCC
GTGCTGCACTCGACGGGCGAGGGCCCGGATCACTGCCCACGCCCGACGGCCGGCGTTGCCTACCGCAATTTGCGCGTCCA
CGGCTACGGCAGCCCGACCGACTACCAGAAGGACGTCTTCAACGTCCTGCTGCAGGCCCCGCTCGAGGCCGCTCAGTACT
TTATGAGCAGCCGGCGCGGACGCGAGGTGCCCATCCTGCGCGACGGCTTTGACGGGCTCGTGCGCAGCGGTGAGATGCTG
CTCGTGCTCGGTCGTCCCGGCAGTGGTGTCACCACCCTCCTCAAGACCGTTGCCGGCGAGACCAATGGCCTCCAGGTCGA
CGCCGAGGCCTTTATCTCGTACCAGGGCATCCCCATGCAGGCCATCCAGAAACGCTTCCGCGGCGAGGTCGTCTACCAGG
CCGAGACCGACGTCCACTTTCCCCAGCTCACCGTCGGCCAGACCCTGCTCTTCGCTGCCAAGGCACGCACTCCTCAGATG
CGTCCCGATGGCGTCACCCGTGCTCAATACGCCAAACACATCCGCGACGTCGTCATGGCTGTCTTTGGCATCTCTCATAC
CGTCAACACTCGCGTCGGCTCCGATCTCGTCCGTGGTGTCAGCGGTGGTGAGCGCAAGCGTGTCAGTATCGCCGAGGTCG
CCCTTAGCGGCAGCGCCCTCCAGTGCTGGGACAACAGCACCCGTGGTCTCGACAGTGCCTCTGCCCTGTCTTTTGCCAAC
ACTCTTCGCCTCTCGACCGAGCTCGCCGGCACCACTGCTCTCGTCGCCATGTACCAGGCTTCTGAGGCTGCCTACGAGAC
TTTTGGCAAGGTCTGCCTTCTCTACGAGGGCCGCCAGATCTTCTTCGGTCCCGCCAACGAGGCCAAGGCTTTCTTCGTCG
ACATGGGCTACGAGTGCCCTGATCGCCAGACCACGGCCGATTTCCTCACCTCGCTTACCAACCCTGGCGAGCGTGTCGTC
CGCCCCGGCTTCGAGAACCGCGTCCCTCGCACCCCTGACGACTTTGTCGCCTACTGGAAGGCCAGTGCCACTCGTGCTAG
CCTGTTGCAGGACATTGCCGAGTTCGACCAGGAGCATCCTATGGACGGAACCCCCATCGAAGCTATGGCCACCGTGCGGA
AGGCACACCAGGCCCCGCTGACGTAAGCTATTTCCCAATACAGAAACCACTGATCTTCTCTCGCTAACTTCAAGCACAGT
CCCAACAAGTCTCCCTTTACCCTCTCGTTCCCCCAGCAGGTCGCTCTCTGCATGACCCGCGGCTATGAGCGGACTATGGG
CGACAAGACCTTTTTCATCGTCACCGTCGGCGGCAACCTCGTTATCTCCCTTGTGCTTGGCAGTGTCTTCTACCAGCTGT
CTCCCGATGCCTCTAGCATCACGTCGCGCTGCATCTTGCTCTTCTTCGCCATTCTGTTCAATGCCCTCAGCAGCTCCCTG
GAAGTATGTTTTCCCCGTCTCTCTGCTTCTCTCCTCCGTGCTAACCGCCTAGATTCTCTCTCTGTATGCCCAACGTCCGA
TCGTCGAGAAGCACGCCCGCTATGCACTCTATACACCCTCGGCCGAAGCTGTCTCGTCTGCCTTCTGCGAACTGCCCTCC
AAGATCTTCTCCGCTATCGCTTTCAACATTCCGCTATACTTCATGGCCGATCTTCGACATGGCGCCGGGCACTTCTTCTT
CTTCTTGCTGTTCGCCTTTACGTGTACCTTGACCATGTCCTTCATCCTGCGCACCATCGGCCAGGCTTCTCGCACCGTTC
AAGAGGCTCTGACTCCGGCTGCCGTGTTCATCATATCTCTCGTCATCTACACTGGCTTTGTCATTCCCGTCAAATCCATG
CAGGGCTGGATGCGCTGGATCAACTACCTCAACCCCATTGCCTATGCCTACGAGAGTCTGCTGGTGAACGAGCTTAGCGG
CCGCAACTTCCCCTGCGCCTCGTTCGTGCCGGCGTACCCGAACCTCTCCAGTTCTGAGCATACCTGCTCTACTGCTGGCG
CTGCCCCGGGTGCCGACTTTGTCGTTGGTGACACCATTCTGAACAGCAGCTACGAGTACTACCACGCTCACAAGTGGCGG
AACCTGGGCATTCTCATCGGTTTCCTGATCGCCTTTTTCTTCGCCTACCTCGTGGCCTCTGAGTACATCACGGCCGAGCA
GTCCAAGGGCGAAGTCCTCGTCTTCCGCCGTGGCCACAAGGAGTCTGCCGTAGTCGAGAGGAAGACTGCGACCTCGGACG
ACAGCGATGGCGAGAAGGGCCACCAGACCGAACAGAAGGACATCTGCCATTGGCGCAATGTGTGCTACGACATCACCATC
AAGGGCCAGGGCAGACGTCTGCTGGACCACGTTGACGGCTGGGTCAAGCCCGGAACTCTGACCTGTCTTATGGGTGTCTC
TGGGGCTGGAAAGACCACTCTGCTCGATGTCCTCGCAAACCGCGTCACCATGGGTGTTGTCACAGGCGACATGTTGGTTA
ACGGAAGCCCCCGTGACAGCTCCTTCCAGCGCAAGACCGGCTATGTTCAGCAGCAGGACGTCCACCTCGAGACCTCGACT
GTGCGCGAAGCCCTTCGCTTCAGCGCACAGCTGCGGCAGCCAACAACTGTCAGCACCCAGGACAAGTACATCTTTGTCGA
AGAGGTTATTGAGCTGCTCGAGATGGACGAGTATGCTGACGCCATTGTCGGCGTTCCTGGTACCGGTAAGTCTGACCGTC
TTTCTATTCGTTTTTCTTTCCAGCGGAGCGTGTCTGACAGAATAAACAGGTCTGAACGTCGAACAGCGCAAGCGCCTGAC
CATTGGTGTGGAGCTTGCTGCCAAGCCCGATCTTCTGCTCTTCCTCGACGAGCCCACGTCTGGCCTCGACAGTCAGACTG
CCTGGTCCGTTGCCGCGCTCATTCGCAAGCTCTCTGCCCGCGGCCAGGCCGTTCTGTGTACCATCCACCAGCCGTCCGCC
CTGCTGTACCAGCAGTTTGACCGCATTCTCCTGCTGGCTGCCGGTGGTCGCACCGTGTACTTTGGCGACATTGGCCCGAA
CGCAGAGACAATCATCAGCTACTTTGAGCGGAACGGCGCCGAGCCCTGCGGACAGGACGAGAACCCGGCCGAGTGGATGC
TCTCTGTCATTGGTGCTGGACCGGGTGGTGTAGCAAAGCAGGACTGGGTCAGTATCTGGCGCAACAGCGACGAGTACAGT
GCCGTTCAGGCCGAGCTGGATAACCTGGCCAAGCGCAAGGACACTATGGCTTCTAGCGGCGCAACTGACGCCGCTGCTGT
CACCACTTATGCCACGCCCTTCTTCTTCCAGCTGTACATGTGCTCCAAGCGCGTCTTTGAGCAGTACTGGCGCACTCCGT
CATACATCTACGCCAAGATGATCCTGTGTTTCGCGGTCGTACGTTGCTCCTCAAGATTTTGCTGCAGTCCATCCTTGCTA
ACCCCCATCTAGTCTCTCTTCATCGGTCTCTCTTTCCGCAAGGCTCCCTTGTCCGAACAGGGCCTGCAGAACCAGATGTT
CTCCATCTTCATGCTGCTTGTCATCTTCGCCTTCCTCGCCTACCAGACGATGCCCCATTTCATCCGCCAGCGCGAGCTCT
ACGAGATCCGTGAACGTGCCTCGCGCACGTACTCGTGGTATGTCTTTATGCTGGCCAACATCATCGTGGAGCTTCCCTGG
AACACCATCGCCTCGCTGCTCGTCTTCCTGCCGTTCTACTACATCGTCGGCATGAACCACAACGCAGAGGCGACGCATTC
GGTGTCTGAGCGTGGCGGCCTCATGTTCCTGCTTGTCTGGGTCTTCCTCGTCTTCGAGTCTACCTTTACCGACATGGTTG
TGGCTGGCTCGCCCACGGCCGAGCTGGGTGCCACCATGGCCCTGCTGCTGTTTGCCTTTACACTGATCTTCTGCGGGTAT
GTTATTGCATCCCAATGTCTCTCTCTTTCTCCTCTCCACATGCTAACCAAATTGCAGTGTCATGGTTGGAAAGGACCAAC
TTCCTGGCTTCTGGATCTTCATGTACCGCGTCTCACCCTTGACGTATCTAGTCGGTGGCCTCTTGGCTACTGGCGTCGGC
CATCACGAAGTTACTTGCACCGCTCGGGAGCTGCTCAGCTTTCAGCCGGTCGGCAACCAGACCTGCCTCGAGTACATGAC
CCCGTACATGAAGCTCGCCGGTGGCAAGGTGATCAACCCGAACGCCGTGGCCCCTGCTAGCTGCGAGTTCTGTACTCTTG
CCAACACCGACGCCTTCCTGGCCTCGATCAATGTCAGCTACGACCAACGGTGGCGCGACTTTGGCCTGATGTGGGCGTAC
GTTGTCTTCAACGTGTTCGGTGCTCTGTTTATGTACTGGCTTGTTCGGGCCCCCAAGGGCGACCTGAAGGCACGCCTGTT
CAAGCTGGTTGGCAAGACTGCGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62