GenePrediction:GLEAN_8031 Details

Name: GLEAN_8031
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1503345..1502911 (- strand)
Length: 435
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1503345..1503253 (- strand)
Length: 93
Type: CDS
Source: GLEAN
Position: GCSC_113:1503187..1503047 (- strand)
Length: 141
Type: CDS
Source: GLEAN
Position: GCSC_113:1502985..1502911 (- strand)
Length: 75
>GLEAN_8031 class=GenePrediction position=GCSC_113:1503345..1502911 (- strand)
ATGCACCAACTCGCCAGCCTGCGGGCGGCCTTCCGGCGCTATGCCACGGGCGCCAGCCGGTCTCGTCTTGACGGCACTCT
GAGTCTCGAGCATGTAGGCCGTCCTCCTACGTTTCGCGTCTACTGCAAAGCGCTGCCAGCTCTGACGCCTCAATCTAGTT
CCTGCAGCGCTCCCGGGTGCTGGCTCTCTACCGGCGGATCGTCCGGGGCACACACCACATCGGCGACCCGACATTGCGGG
CGGAGACACACCGATATGCCCGAGGCGAATTTGAGCGGAACCGAGACGTGACCGATCTTGTGAGTGGCCGCGACTGCAGT
CACTTCAGTCCATGATCGATCGAGTCACTAACTAAGCTAGGCGCACATCCGCTACCTCGTCTCGACCGGAAAGACGGAGT
GGGAGGCAATGGAGAGGTATATTGGTCGTCCATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62