GenePrediction:GLEAN_8032 Details

Name: GLEAN_8032
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1501841..1500572 (- strand)
Length: 1270
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1501841..1501831 (- strand)
Length: 11
Type: CDS
Source: GLEAN
Position: GCSC_113:1501774..1501609 (- strand)
Length: 166
Type: CDS
Source: GLEAN
Position: GCSC_113:1501549..1500572 (- strand)
Length: 978
>GLEAN_8032 class=GenePrediction position=GCSC_113:1501841..1500572 (- strand)
ATGGCCGATGAGTATATTTTTCTTTCGGAGAAGCAGAGGTTGGAGTGCAAGCTGACCTGGCTGTCAGAATGCATCTGTCG
ACGGTGGAGGAGGTGCTGAAGCATCCGTCGTATCCGGACGCCACGTTCAACCTGAAGCCGACGAGTAGTGGGCTGCTGCC
TGTGGCTGAGGGCCGGGGAGGGCCGCTGAAAATTGGCTGGGAGATCCACGGCTCGGGGCCGATTCGCATGGTGGTAGGTT
GGAGGGGGTGGAACACGACTGACATCGTTCTGCCAGCTGACAGCGGACGCAGTTCATCATGGGACTCGGCTCGTTCAAGT
CATCGTGGCAGCGCCAGACGCTGTACTTTGGGCACGAGCGCCACGCGGACTTTTCCGTGCTGCTAGTGGACAACCGCGGC
ATGGGCGACTCGGACAAGCCGCTGATGCGGTATTCGACGAGCGAGATGGCCCTGGACGTGGTGGAGGTGCTGGAGCACGT
CGGCTTCGTGGAGCGGACGCCGGCCGGAAGTGAAAGTGCTGCCGGGCTCGCTTTTACGCCGGCAAGCCAGCGAGCCGTTC
ACGTGATCGGAGTCTCGATGGGCGGCATGATTGCGCAGGAGCTGGCGTGCATGGCGCCGACGATTGTGGCGTCGCTGTCG
CTGTGCTGTACGGCGGCCGCGATTGAGAACACGTCGCCGACGATCTGGCAGAACCTTGCCAGCCGCGCGGCCCTGATCGT
TCCCAAGGGCGTCGAGGAGAGCGTCCGGGGCGCGGCCGGACGCATCTTTGCCCACGACTGGCTACCGCAGCCGGACAACG
TGCAGCTGCCGAAGCGGGGAACACATCTGGTCGGACCGCCGCAGCGAGGGTGCCATGGGGACCAGAAGCAGCAGGACGAC
ACGGACGACAAGGACGACCCTTGGTATCGCCTCTTCGATAACAACTACCAGCGCTTCGTTGCCCAGGAGATGCACAAGCG
GCTCGACCCGCGCTTCTCTACGGCCGGCTTCCTCATGCAGCTCATCGCCTGCGGCTGGCACCACAAGTCTCCGCAGCAGC
TGGTCACCATGGCCGATCAAATCGGCCGCGACCGCATCTTGGTCCTTCACGGCACCGCCGACCACATGATCTCGCTGCCC
CATGGCCGCAAGCTGATCGAGTACATCCAGCCGGGCGCCGCACACATTATCGAGGGCATGGGCCACGCCCCCCTCGCCGA
GCGCTGCACCTGGTACAACAACCTCTTGGAGGAGCGGGCACGGGCGGGCGAGAAGTTGGCGGGACGATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62