GenePrediction:GLEAN_8036 Details

Name: GLEAN_8036
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1487402..1483861 (- strand)
Length: 3542
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1487402..1486093 (- strand)
Length: 1310
Type: CDS
Source: GLEAN
Position: GCSC_113:1486036..1485842 (- strand)
Length: 195
Type: CDS
Source: GLEAN
Position: GCSC_113:1485781..1485281 (- strand)
Length: 501
Type: CDS
Source: GLEAN
Position: GCSC_113:1485217..1484708 (- strand)
Length: 510
Type: CDS
Source: GLEAN
Position: GCSC_113:1484482..1483861 (- strand)
Length: 622
>GLEAN_8036 class=GenePrediction position=GCSC_113:1487402..1483861 (- strand)
ATGCAGTCTCAGCAATCCTGCCGCACCAGTCAGACAGCACCAGCTGGCACTTCCCACGCACTTCCGTATCGGCTGGAGAG
GAAACTGGAGCAGAATTCGTCGCTCGTCAGTCGTCCACCACACCACGACCCTCACCCACGGCCAATCTCGAGCGCCAAAA
CAGCACACCCGCTGCAGCAGCCGGCCGCGGATGTACATCTTACTGGCGGTCTAAGGCTGACGCCACTCCAAATGGCGCAG
CTCGATACAAGAGGCCCCGGCGACTTTGGTGACTCTGGCTCCTGGTGGCAGACGGCTCCCGGCCACATGCCCTCGCCCTC
GGTCTACGAGAAGGAGGACTGGATGCGAACGGAGTTGCCGTCGCCCCTGCCATCGCCTCGCCATTCTCGGAGGGACGTAC
ATAGATCCGCCTACTCAGCCTACTCAGCTACCCCGTCGTCCGTTGCTACCTCTCACCAACGACCGGCCGTGAGCCTGGCA
GCATCCCTACTGGCTTTACCACGAGGCATGCGACAGCACAGCTCTGCCAGCCCGCTTGTCGGACGGCCGCCGGCTGCGCC
AATTCCGTTTGCCCGGGCGTCCACTGCCCCAACCGGGAAGCGGGCCACCGCCACCACTATTCGCCCCTATGAAGGCCGGT
CTCAGTCTGGCAGCCGTCGCACGGCTTCCCACAGAGACCAGAGTCCACGTTCGGCTCACCACTACCGCTCGACCCCCGAA
ACTCGCCGGTCGGTGCGGTCCTCCTTTGACGAGTCCGAGAGAGAATCGGACACGACCGACTCCTCGCAAGACGAGGAGGA
CGATGGCGGCGATGGCGTCTACGTAGACAAGAATGCCCTGCGCGACCGTCTCGACATCCGCCGCCGATCCAGCAGCCAGC
ACCGCCAGGCGCAGGACTCGGACGGCCCACAGCGCGAGGGCGGCGAGGACCGCCAACGGCAGCGCGAACAGGGACAGCGA
CAAGGGCAGGGCCCAGGCCAGTCCCAGCCGGGGTCTTCTCGACGCACCGCCCCTCGTCGCAGCACCGAGAGCCGGGGTGC
CGGCACCGGTCGCAGCCGGAGCAGAAGTCGGAGACGCGAGAAGGTCATCTACGAAGAGGATGCCGAAGCAACCGAGGATG
TCACGGCCGAGGAGGACGACGACAGCGATCCCCCTCCACGGCCGGCAGCCTCTAGGCAGGCTAGCAGAGCGCCCACGTCC
CGGCACACTTCTGCCACGCAGGCGACGCGCTTTGCGCCAAAGCGTGGCAAGAGCCTGCGCCGTCCCGGCAGTTTTGACGA
CGGGTGGAAGAACAGAGCAACTTCGAGAAGGTAGACAGTGCCAATGTGTCCCGTATGTCGAATGTGTGACTCACCTGTCG
TTCTAGCCGGCCGTCATCGAGACGATACTGCGAGACAGAAGTCCCAGAATCCTACGCCAACAACACGGCGCCTCTCCGCC
GAGCACAGACGCAGCCTACGGCGCCTCCGATGGCCTCGTCGCCGAGTGTCGGCTCGTCGAAACTGTCGGTACTGGGGGGC
TTCGTCGGACAGGCGCCTGCCAATGAGATGCCGAGTAGCCAGTGAGTTGTCCACCCATGATTGGTGCCGTTCGTGCTAGC
CGCTGACCGATGATGTCCTAGCCATGACTGTGCAATATGTGGCGAGGAATACGCACTGTCCCGTCTGGCCAAGCTGAGCT
GCAATCACCGGATGTGCAGCTCCTGCCTGAAAGACAGATTTGCAAAGGCGATGTCGGACCCGCGGGCGATGCCGCCGAGG
TGCTGTGACAGGCAGATCCCGCTGAAGTACGTCGAGAAACTGTTTGATCTGGGCTTCAAGCGTGCCTGGAACCAGAAGCT
GCGCGAATATGCGGCTCAGTCGCGGCCTCACTGCCCACGGTGTGGAGAATGGCTGAAGCCGGACGACATGTACTCGGCCG
ACGACCGGAAGGCGGCACAGTGCAGCAAGTGTAGGACGAAAGTGTGTCGTCTGTGCAACGGGCCATGGCACATATCGCGC
CAGTGTCCTCCGCGAGAAGGGTCCAGCCGGTTCCTGGACGAGGCCAGAGCCGAGGGCCGGCAACGATGCTACAAATGTCG
GGCCAGGACGCCGCTCTATGACAGCCAGGATCACGTGACATGGTATGAAGTCCTCTCTGACACATGGTGGTATGTTGCAT
GACAGTATGCTGACCTGGCGTTTAGCGGGAAATGCGGAGCAGAGTGTTGTATGGTGTGCGGCACGAAGTGGAAGACGTGT
GACTGTGCCGTGTTTGAGTGCGACGCCGGGGACACCAGCCGATCCGAGTACACGCAGAAGCCGTTCAACAGCATGCGAGG
CGACCGCTTTGGCTCGGCGGCGACTTCGATCCGGGACTTCCACCACGGCCGGGCGGCCGGCACTGCCTCTGCCGGCGTGT
CGGTGGTGGCCCCTACGAGGCAGGACGACGAACGCACGTTTCTGCAGCGGCGACTGCACGACCCGCGAGACGATGATCTG
GCCAACCGGATGCACACAGCCTTCACCAGCTTCGGCGACGAAGATCGGTCGGGATACTACGATGGCCGATACCGCGAGGC
GGAAGAGCGATCGGAAGACGAGACGGAAAAGTATCCGAGGCGACATGCCGAAAGCGACCTGGGTGTGTATGCTCGCGGGC
GGCACAGTTTCCTGGAAGAAGGCAGCCGACAGCGGTCAGCCACGGTGATCCTGCCGTCAGTTCCACCTCCGCCGCCGATG
CCTCCGACACCACCGCAACAACAGGCACAGCCGGTGCACCACCAACAGCACCAACAGCACCAACAGCACCAGAAGCAGCC
ATACCAGCACCAGCATCAGCGGCCGCACCATGACCAGCAATACGAGCCGCACCACGACGATCACCACGACCCGCACCACG
GCCAGCTGAGCCCGTTCTCGCCCGCACCGTTTGACAACAGGCCTCCTGCAGGAGGCAACTACTACGTGGCCGGCGTGAAT
ATGGCCAGAGGGGTTCGCGGGAGCTCCCAAGACCGTCGGCTGGCCGACCGGTTCAACGCCGACTACAGGACCAATCCGGC
ACATCGAGGCATGCTGTCCACCATGGCTATGGCACCTGCTATGGCACCTGCTATGGCGCCTGCTATGGCGCCAGCCACGG
CACCTCCGATGACAGGCGTGGGTGCGCTGTCGGCACCGGTCAGAGCGTCCATGGGAGGGATGCCGATGGTACCGATGGGG
CCTATGCTCCAGCCGGCCATGTCACTGGAGGCACCGCTGATGCGACGACACCCGATGGAAGGCGACGTGTTTGACAGCCC
GGATCTGCTTACGTCATGGCCCGAGCACAACCCATACGCCGTCGACCACCACATGCGCTACGGCGACATGGAGGCAGAGG
CGTACGGCGTGCCGCCATCCAGGGGACGAGGCGGGTGGCGACGCACCGTGAGAGATGAGAAGCCCAGGTCAGTGATGGCT
GGCCTGGCCGGGCCTGACCGCGGCATGGGCCGCGTGGGTGAATGGCTTTCGTACGTTGATCCGGGTGATTTGGAGGGCGA
TACGGATTCCATCGACGGATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62