GenePrediction:GLEAN_8039 Details

Name: GLEAN_8039
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1469825..1467555 (- strand)
Length: 2271
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1469825..1469189 (- strand)
Length: 637
Type: CDS
Source: GLEAN
Position: GCSC_113:1469012..1468827 (- strand)
Length: 186
Type: CDS
Source: GLEAN
Position: GCSC_113:1468763..1468389 (- strand)
Length: 375
Type: CDS
Source: GLEAN
Position: GCSC_113:1468321..1467555 (- strand)
Length: 767
>GLEAN_8039 class=GenePrediction position=GCSC_113:1469825..1467555 (- strand)
ATGCAGTCACTCTTCCTCAGCGACGTAGAGCTAGGAAAGAAGGATGACGACCACAAAACCTCAAAAGGCGGCGTTTCGAG
CGTGCGCATGCTCGTTCCCACGGCTGCGCGGGTACACCCTCGGAAGTTTCTCAAGCGGCTACTTTTCGCCACTATAGCTG
GCTTCGTCATCTACACCTTTATACGGAACATACCCTCAGACGTTGGTGTTCGCGATCGGCGGCGCCCTGTGTATGGGCAG
CCGGCGACCGGCTTTTCGGCCGGGGCGCAAGTCCCACTAAGCGAGCAGGACGGCGATGAGACCAGGACAGGTGCGGATGG
AGAGGACATTTCGGTGTTCACATACAACGGACCAATTGATCGACTGTCACGGCTGTTCCCGTCTCTTCGCACCCTCGGTA
GCACGCGAAGCTCACTTCTGGTGAATAAGCATGTGCTTTTTGTGGCGGCAAGCTTGAAAAGCACCACAGCTCTTCTTCCC
ATTGCCTGCCAGATGGGCTCCGAGCTCCGGAATCATGTGCAGTTTGCCGTCGTGGGTCGGAACGAGATCGATATAGAAGA
GCTTGAGCAGATGAACGGCATCGACGATTCATGCCGCATCACCTTTCACGGCATGTCCCTCTTGTGTTCTTCCCCCGGTA
GCAGCAGAACAGTGCTAATAAGATGTCCCTCTTTCAATAGACGGTCGTCCCGACTATGCATCTATTTCAACGGAGGCGCG
CATCGAGAAAAGCGCCAACCAGGCACTAAGTACAACTTTGTCCACGTACATCTTCCGTGTCTTGTGTGCCCTTGCTGACG
GAACAATCAAAAGGAAACATTGAGCTGTACATGCACCCACAAGTCATCGTAGTGGATGGCACGCCCGCCGAAGAACTATT
TTTAAAGAGGGCGCTGGCTGTATATGTAAAAAGAGCGCCGACTACCATTATTGAACTGCCGGAAGATGGTGCCAAGCGTT
TCGGCTGGATTGCAAAGCTTGACTCTGTATCATTGACGAGTGCGTTGGGGACCCTTCGATATCCGTCGTATCTCATACTT
CCTGCTGACGATGCATCTATAGACTGGAATTCGTTCAGCATTGATATCCTTATTCAGGCCGTCCCAGGCGCCTCTGGAAG
TCTAATCCGGCTGCTGAAGTCACTGAGCCGTGCTGATTTTGGCTCTCGAGCTGTGCCGCACCTAACGATTGAGCTCCCTC
AAAAGATAGACCTTCCAACACAAGAGTACCTGGCAACCTTCCAGTGGCCCCCGCTGCCAGAGGGCGATCCCCCAGCTTCA
CGGCAACTGTCCCTGAGACACCGCATCGTCAGTCATGGTATTAATGAACGAGACAGCTCCGTTCGATTCCTCGAGTCGTT
CTGGCCGGCCGACCCAAAGAAGTCGCATGTTCTTGTGCTCTCTCCACAGGCGGAATTATCGGAAGATTTCTTCCATTGTG
GGTGTTTCACTTTATGCTTTTCTCCCTGTTTTCTGGCAGTTCCAATCAGTGCTAATATATGCAGATGTCACGTACACTCT
ACTCGAGTATCGATATTCCGGCCTACCGAAAATAGAGAAGCAGCTCTTTGGGATTAGCTTGGAACTCCCTTCGACTGCTA
TTGACGGCACCAAGTTCTCGCCTCCAACTTCCCTCTACGGGAAAGGCAGATCGGACCGTGAAGGATCTGTCCCATTCTTA
TGGCAAGCACCAAATAGCAATGCCGCCCTGTTCCTTGGAGAGCGCTGGGCAGATCTGCATGGATTTGTGTCAGAGCTGTT
GACGAGACAGCCAGCGGTAGGCGCAGATGGTCAGCCGCAGCCAAAACTTGCCAACAAAATGTTCCCATCGTGGCTAGAAT
ATGCCCTGCAACTTTGCCAAGCCCGTGGATACTGGATGCTGTACCCGAGCGGGACTACTGCCGGCGCTCTCGCCACTATC
CACAACGAACTGTACAGACCGCCGGAGGAATACGAGAAAGACGTCGTCAGCGAAACAGAAGACGACCCGACCGGCGGCAA
AATACTGCACGGGGGTGGCGTTGCAGATACCGAGGAGGCATCGCTCGGACCCAGCGCTACTCTCTTGGACGTTCTGCCTG
AAACAGGCGGCCTGCCATCCTTTGTGGAACTTCCTCTGCTCACGTGGGAGGGCAAACAGGCGACCTTGCGAGATGTTGAT
GTCCAGGCAGCCGAGTATGCGCGGAATCTCCAGCTCACAGTTGGCGGTTGTGCTGCTACGGAACTGAAGAACCTACCGCT
GGGAACACTGTTCTGTGAGCAGGATGCGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62