GenePrediction:GLEAN_8040 Details

Name: GLEAN_8040
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1460313..1459555 (- strand)
Length: 759
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1460313..1460154 (- strand)
Length: 160
Type: CDS
Source: GLEAN
Position: GCSC_113:1460066..1459839 (- strand)
Length: 228
Type: CDS
Source: GLEAN
Position: GCSC_113:1459766..1459555 (- strand)
Length: 212
>GLEAN_8040 class=GenePrediction position=GCSC_113:1460313..1459555 (- strand)
ATGTTTTCAGCACGGACGCTCATCTCTCGCCCCATTCTCGCCTCTGCGGCATCGGCTGTCGCGATCTCTTCTGCCAGAAC
AGCATTCCGTACTGCGCGGCCAACGATTGCCGCGTCTGCTGCGGTTGTTCCCAGCGCACGGCGTCTCTACCACGAGAAAG
ATATGGCTTCCCTATTCTTCAGCTATCGACAATTGATAGTCGACATGCCTTTCTATATCAAGCTGCACCTGCTAACTGTC
TTAGCACTGATCGACCACTACACTCGGCCACGCAATGTCGGCTCTCTCGACCGGAAAGACCCCTCTGTGGGATCGGGATT
GGTAGGCGCACCAGCTTGTGGCGACGTCATGAAGCTCGACATCCGGGTCGATCCTGTCACCAACAAGATCATCGAGGCCA
AGTTCAAGACGTTCGGCTGTGGCTCAGCCATTGCCAGCTCTAGCTACCTTACGACGCTGGTGCAGGGCAAGTCTTGTAAG
TAGCATATGCACACACAGGCTGTTGATGGCTCTCGGGTCCTAGCGTTGTTCTGACTTCGTTTTGCAGTGGACGACGCCGC
CGCCATTCGCAATGTCGATATCGCATCCGAGCTCTGCCTACCTCCGGTCAAGCTGCACTGCTCAATGCTTGCAGAGGATG
CTATCAAGGCCGCTGTTGCCGACTACCGGAGCAAGCGGCCTCAGACCAACTTGGGCGGCACTGGAAAGACCATCTCGCAG
GCACCGCCTGCACCTCAGGCAGCAGCAGCGGCTATCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62