GenePrediction:GLEAN_8041 Details

Name: GLEAN_8041
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1458419..1457171 (- strand)
Length: 1249
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1458419..1458092 (- strand)
Length: 328
Type: CDS
Source: GLEAN
Position: GCSC_113:1458036..1457910 (- strand)
Length: 127
Type: CDS
Source: GLEAN
Position: GCSC_113:1457808..1457657 (- strand)
Length: 152
Type: CDS
Source: GLEAN
Position: GCSC_113:1457481..1457171 (- strand)
Length: 311
>GLEAN_8041 class=GenePrediction position=GCSC_113:1458419..1457171 (- strand)
ATGTCCAGCCTTTTACGGCTATTTGCCACTCTGACCCTCCTTCTTGGAGTGGCTCTGATGCTCTTCTCGCAGCCTGCAGA
GGCGGCCAAGGGCCCCAAGATTACCCACAAGGTGTACTTCGATATCACTCATGGCGATGAGCCAATTGGACGCATTGTCA
TGGGCCTCTATGGCAAGACGGTTCCTGAGACCACGGAGAACTTCCGCGCCTTGGCTACTGGCGAGAAGGGTTTCGGCTAC
GAGGGATCGAACTTCCACCGTGTCATTAAGAACTTTATGATCCAAGGCGGTGACTTTACCAAGGGTGATGGCACCGGCGG
CAAGTCGAGTATGTGTCCTCATCGAGCTACTTCCTAGCATACCTTACCTAACAATTGAACCAGTTTACGGCGACCGCTTC
AAGGACGAAAACTTCAAGCTCAAGCATTCCAAGAAGGGCCTTCTCTCCATGGCCAATGCTGGAAAGGATACCAATGGCTC
GCAGTTCTTCATCACCACGGTCATCACTTCGTAAGTTGATGCCAGCGTCTGCTCTCCACCGATTGGCGACAGCCCAGTAC
TTCGGCGAAAAATGACCAGAACTATGTACTTACGTATTGTCTGAATTGCAGATGGCTTGATGGCCGCCACGTCGTCTTCG
GCGAGGTCCTCGAGGGCTACGACGTCGTTGATATCATTGAAAACGTTCCGAAGGGCGCCTCTGACAAGCCCGTCAAGGCA
GTCAAGATTGCTGCGAGCGGAGAGCTGCCGGTGCCAGCAGAAGGTATTCACGTGGAACTATAAAAAGTACAAGAAATAGT
GGCGAGATGAGAATGAGAATGAGTGATTTGAGGGCAACCTATCCTACATCTTCATTTGCTTGTCCCCACTCTATCTATAG
CTCATCGTCTTTGAGGCAATGCTGATTGTTTGCGCCTTTCGTTCCCACTTTACCGCAGCTTCTGAATATGGCTCCTCTGA
ATGGGCCATTGGTACCGATGGCGAGGCAGAAGAAATTCCTGCGACGGAAATTCCCGACTCCGACAAGGAAGACGCTCCCG
CTGTTACCGCCACCTTGACCTCGCCGGCCATTCCTGCACCGACCTCCACCGAGAAGGCCAACCCATTCGACACTGACGGC
AGTTCAGAGGGGTGGTCTGTGCTGCAGAAGGCGTTTCTTTTTATTATCATCATTGCTGGTATCTACGTCTGGATGAGAAT
ATCGAAGCGCAACGGCGCGAAGGCTGGCTACGAAAAGACAACGGTGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62