GenePrediction:GLEAN_8044 Details

Name: GLEAN_8044
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1452042..1450530 (- strand)
Length: 1513
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1452042..1451775 (- strand)
Length: 268
Type: CDS
Source: GLEAN
Position: GCSC_113:1451710..1450530 (- strand)
Length: 1181
>GLEAN_8044 class=GenePrediction position=GCSC_113:1452042..1450530 (- strand)
ATGCTCGCAGCACACGACCAGGAAAATCGCCTAATTGGACACAGCCTAGGCGGTGCATCGGGAAAGCAGCAAGCACTACA
GCCGAAGACACCGGGAGCCAAGTTTCCAAAGACGCCGCTGAAAAAGATGCCGTTTAACGACCAGAACGGAGCGACGCGGC
TGGCGGCCGGCCGAAGCGTCTTGGGAGGACGGCTTGGTGGGGGGATCGAGAACATGCAGCAGACGGTCGGGAAGGCGGGC
AAGGCTGGCGTCTTGGCCACACCTCGTGGTAGGTATTTTTGTGAGTGCTGATCGATGCCGCGGACGAGACGCTGACAGCG
GATCACGAACAGAGCCGAGAACTGTACGAGCACCTCTGGGCAACAAGACGACCAATGCAAAGGCCCAGACGCTCTACCAG
CACCAGCAGCAGCAGCTGCAGAAGCAGGGCGTCAAGGAGCGGATCAAGGAGATTGAGAAGTCAGCACAGCAGGCGCAGCC
GACGTCGACACGACGGGCCCGTGTGATCTCGCCGCGTGTCAACCCGTCTAAGCTGTCGGTGCTGAACGACAAGCGGGCTG
GCGGGAGAGGCGACCGGGACAACGCCGAGGTGGAATACGCACCGCCGCCGGTGGTAGCACGGCCGTTCGAATCGGATGTG
TTCCCCAACGGCGCGCTCACGTTTGCGGCGTTCCGGCCGGCCAATCGGCTGCGCGGCTACTACGACCACTACTACAACCC
GGTCGATGCGAACGGGCTATCCCGACGGGACAAGGAGCTGGCCGAGAAGCAGCAACGGGCGTTTGAGAAGCTCGACATAT
GCGTGCAGGACGATCTGAACTCGCTCGACTGGTCCATTGGAGACGTGCCGGCCAGTAAGGGCTTCGTCGCGAAGCAGAAG
CAGACACAGACACAGACAACGGGTCTGGCCAAACAAGCGCCAGCAACGATTGCCGTTCGCAACGCAGCAGCAGCACTGGC
CCTGGGCGCCAAGAGCGGCCCGCCGCAGTCCAAGGTCGGCAGGCCTGCAGGCGTCCGGACGGCAGCGACAGCGGCGTCTT
CATCGTCGACGTTCGTATCTGGTCTACCACTCCGCAAAGGGCTGCCAGCCAAGTCGGTGCTGGCCCACCGGCCCAAGACC
AGCCACTACGCCGTTGCAGAGACGGCTTCCCGCACGACGCTCGGCTACACCAAGGGCCGGACTGCACTGTCGCTTGTGCG
AGGGAATACGGTGGCCGGCCGTCCGCCTGCAGGGCGCTCTGCAGTCACTGCACGGCCAAGGACAGCTGGCGGCGTGCTGG
AGAGCGGGTCTTCTGCTGCTGTAACACCGGTGTATAAGGCTGAGATGGGGGCCGTGACGACAGAAGAGGTTGTCAGCATG
GGTGCCGACGACGACGACGGCGACGCCTCTACGAGGACTCCTGCATTTGTGTCGATCTTTGACGTCGAAGAAGAATCGGG
CGAATTGGGCGGGGCGGGTACGGTGATCAACGACGATCTGGACGACGACTTCCAGCTGGACGTGCAGTTTTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62