GenePrediction:GLEAN_8045 Details

Name: GLEAN_8045
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1449336..1444670 (- strand)
Length: 4667
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1449336..1448629 (- strand)
Length: 708
Type: CDS
Source: GLEAN
Position: GCSC_113:1448381..1444841 (- strand)
Length: 3541
Type: CDS
Source: GLEAN
Position: GCSC_113:1444773..1444670 (- strand)
Length: 104
>GLEAN_8045 class=GenePrediction position=GCSC_113:1449336..1444670 (- strand)
ATGCCTCCGCCGTCTGGTGCAGGCTTTGCGCAGTTCTTCCCGGCGGCGCCCAGAGCGGCCCGGGATCGTGCGACCGCGAT
GGAACGCGAGCGCGCCAAATTGCGCGCTGCCGAGCAGTCGTCATTCACTCGCGATGGCCCAGAAGCGTCGGCATCGGCAG
CGGCGTTGGCGGTGGCGAAATCCGGTTTGAACGGCCTCGCCGCCTCGGTCCAGCCGCCATCATACACCACAGACGACAGC
GAATCGCTGTTGGGCGATGCGAGCACTTCGACGTCTGCGACATTCAACGGAAACGGCCGCACATTCGGCTCGTCCAAAGC
CCCATCTACCAGCAGCAGCACGGGTGCCAGCAGCTACCTCACCCCCCTCACAACCGATAGCTCGCCCTCCTACCCTGGGA
CAGCCCTACAGCCGGGCGCCTCGCAACAGCAGCAACAGGTTGATCTGCTTAATGAGCAGACGTCCTCCAAGCCGACAGCA
ACACCCCCGACGCTGATTCCGACATCTCTCCAGCAGCCGACTCACCCCGACACCACTCCTCCACACTCTCTCCGCGTCGC
GTCCGAACGCGTACCTGCCCGAGACCCAGGCCGTGCTGTCAAGGGCATATCGTGTGCCTATGACCCCCTCTTGCCCGACG
ACAAACATCTGTCCTCGACCATTGAGCTGAAACGGAAGGGAAAGGCCGTGTACGTGGAGTTTGGAATGGTACGTATCGCA
CTGCAAGTATAGAAGACGCGTTGCCACCGCCAACGAGGCCGTTGTGTTCGAGGACAGCCACCCAGCTACCTGCCTACCTA
CCTACCCGCGCCAGCAAACGCCTGCATATATACATACATATATACATGGGAGAAATGGGACCGCAAGAGGAGGAAGTAGG
GAGTAAATCGGGTCTCAGGGGGGGTGTCATCTTTGAAAATGTTCTACGTGCTAATACTCGTTGCAAATTGTATAGGAAGA
TGATGTCCCCCCTGAGGATCCCCGCCTCGCCAAAAGCGGTCGGCTGAACTACATCAACGTGGACTTCCACCTCGCTCGAG
CCCGGCTGCGCCATGCGCCATATGACCTGCGACCGTACGCGTACGATGCCCGGACGTCTCTTGGACCCGGTCCACCGACC
CAGGTTCTGGTGACGGGCTTCAACCCGCTGGTGCCGTTTACCAAGGTGATTGCCATGTTTGCATCTCTGGGCGAGATCGC
GGAGAGCAGCAACAAGATGCACCCTGAGACCGGCAGCTATCTCGGCTTCGGCACCTTTCGGTACCGCGATGCCAAGCCGA
ATCGGTTCCGTCCTGGCGGCATCGCGGCCATTGACGCCGCTCGACGCGCAGTTCGCAATCTGAACGGCACCCGGATCGAG
GGCAATGCAATCCGGGTCGAATACGACCCTGAGGGCAAGAAGAGCAGCCGCCTGCTGGAGGAGACTCTGCGCCGCGACAA
GGAGAAGAACAGTGTAGCTGGTCCAGCTATGCCAGTCGTAAATGCCGGCACGAGAATACCTACTGCGCCTCGAGGCCTCA
GTGGTGGTGTTGTCCCCGGACCCCCACCAACGGCTCCCAAGGGGCCTGCTGCGCTTCGCATGCAGCAGACGGCCGTGGCT
AACAATCCGGCTGCTGCTGGTGTCCTGAAGAGTGCCACCGGTACCATGGCGGTCACGCCCGGCACGATGGGTGTTGCAGG
CGCCCATCAGCTGCCACGAGGCCCGGCTATGCGGCCGATGGCCGGCATGGCACCTGGACTGAGCATCGAGGCGACTCCTA
TAGCGGTCCAGCTCGAGCACACGCCTTTCATCTTTGTCAGCTCGGAGCACGTGCCGGTAGTGTTCAAGACGATTGCACAT
ATGAAGAAGAGACTCAAGACGCATCAGTTTCAGGATATCCGGGCTGATCGGTCTGGCTACTTCATCGTTTTCCGGGACAG
CTCGTCTGGTCGATTGGAGGCAGAACGGTGCTTCCAGGCCGCCCACCGCACGTCATTCTTTACGTACGAACTGGTCATGA
AACTGTATGCACGAGGCTATTCGTCCGACCAGACGGAAGAGTCCGGTGCGGCAGCTACTTCGGCCGTGACTCCGGCTCCC
GGCCAAAATCAAAATCAAAATCAAAATCAAAACCAAAACCAAAACCAGGGCCACAAACGAATTCACAGCCTTGTGGTAGA
GAAGACAGAGGCGCAGCTGCTGCGCGATGAGCAGGCACAGATGCGTCGAGACGAAGAGGTTGATCTGGAGGAAGAGAAAA
AGCAGAGGGCCAAGAACTTTGACCCGGTCAAGGCGGCCATCAACTCGGTCAAGGTTGAGCTGGTCGAGCACCTTATCCGG
CACATCCGGGCCCACGTGGCAGCACCGTCTCTGTTCACATACTTGGACCCGGCGAACCACGTGGCGAAGAGGCGGCGGCT
GAACATTGGCGGTCCCGAGGCGCCGCGGCTCTCGGCTATCCTGTTTGACGAAGACGATGGCGAGGAGCGACGCCGAAAGC
CGTCACCGATCAGCACGCCGAACTCCAGGGCCGATCCGATCGAGCGGCGCACTGGCCGGCTGGACGTCACATCTCTGCCG
CGGATCCGCAAGGCGAAGGGCGCGACGAATCTGGCGGCTGTGCGGAAGCAGAGCCTGTTCGACCCGTTTGCACGACAACG
CACGCGGCCACCAACGACGCGCGGCGCGTTCCGGTCACTGCACCACCGGCTGAAGGCCGACAGCGACGAGGATTCGGAAG
ACGATACGGAAGCACGGTTCCCGCTCGTACGCGACACCGAGGAGCCGGAGTCGCGGGAGTCAGATGGCGAGCGCGATGCC
GAGGACGAGGAGGACGAGGAGGAGGAGGACCGGGTGGCAAAGAAGCCGTGGGGGCCGGAAGAAGATTCGATGACGGAGTC
GAGCTTCTCGCTAGTGCGCGATGCGTCCGAAGCACGAACCGAGGTCGAGGCGCCGCTAAAGGTGGCAGTCAAGAAGCGCA
AGCTGGACCTGCACATGTCTTCTGCGCTCAAGCGGCAGAAGAGGAGCGACGAGGAGCTGTTTGACGTCGCTCTGGGTGCG
GGCGAGACCAAGTTCCCGCTGACCGACGCGCTCTACGTCGGCGGCGACGACGACGCGCAGTCTGTGCTACCGGCGGCGGC
TGACATTGTGACCACGGCATCGTCCACGCTGGCAGCCGAGGTGCTGTCAGACGAGGGCGGCGAGAAGAAGAAAAAGGCCG
GTCGGAAGGCAAAGAAGACGAAGAAGCAGCTGTTCGAGGAGCGGAAGGCACTGCGGCAACAACAAGAAGAAGAGGCGGAA
CAAGCAGCCGTCGGGAAGGAGGACGAGACGCCGGATCCGGAAGCTGCAGTAGAGCCGGCAGCTGTGGCTGCGCCGACAAA
AATGGAGACCAAGGCCAGAGGACGGGCTGGAAAGACGGCAGCGGCGACGACAGCGACGAGCCAGCCGAAGATGACTGCTG
CAGCCGACGACAAGCAAGCACCTGGCGACGAGGCGGTGGACAGAAGAGCGCCGTTCAACCCGGTTCTGTTTGCCCACGCG
CCGACACGAGCTCTGCTGATGCCGGAGGCATTCCGGCCGAGCCTAGAGATGATCCGGATGCTAGGGTTGCACAGAAGCGA
CCTGCCGAACGGCGAGAAGCTGGCGAAGCGGTTTGGTGACAGCAACGCGAGCTGCGAAACGAGCAGCGATGCGGAACTGT
GGTTGTGGCGACACGAGCGGTTGACGCAGCTGAATGCCGAAGAGGTGCCGCTGCCGGCAGCGGTGACAGCAACAACAACA
GCAACGAGCGGGCGCAAGGGAACGACAGCAGCGATACCAGCGTTGATCGGGGCGACAGAGGCTGAGCGACGACCCCGGAT
CGAAGGCTATTATGTGCCGAATGCGACGGGATGTGCACGAACGGAAGGCGTGAAGAAGATTCTCAACTCGGAGAAGTCCA
AGTATCTGCCGCACCATCTGAAGGTGAAGCGGGCACGCGAGGAACGCGAGGCCAAGGCGGGAAAGGCAGGCAAAGCGGCT
GCAGTCGCAGCAGCCAAGGTCGCGACGGAGAGCTCGGCAACCGGTCGGGGAACGTCGCGGGCCAACCGGGTGAACCAGCG
GCGGTATGTGGCGGACCTCAACGACCAGAAGCGGACGCTGGGCCAGGATGCAGACGCGCTCCGGTTCAACCAGTTGAAGA
AACGCAAGAAGACGGTCAAGTTTGCACGGTCGGCGATCCACAACTGGGGACTATATGCGATGGAGAGCATTCCCAAGGAC
GATATGATTATCGAATATGTTGGCCAAGAGGTGCGGCAGTCGGTGGCGACGATCCGCGAAAAGGCGTACATCCGCGCGGG
CATCGGCAGCAGCTATCTGTTCCGCATCGACGACGGCACCGTCATCGATGCCACCAAGAAGGGCGGCATCGCTCGTTTCA
TCAACCACAGCTGCATGCCGAACTGCACAGCCAAGATCATCAAGGTCGAGGGTAGCAAGCGGATCGTGATCTATGCGCTG
CGAGACATTGGACAGAGTAAGTGAGGAGAAGAGGAGAGAGAAGGCAAAGAAGGCAGAGAGAAAGAGACAAGCTGACAAAT
CAGACGAGGAGTTGACATACGACTACAAGTTCGAGCCCGAGGACAATCCCGAAGACCGGGTGCCCTGTCTCTGCGGCACG
ACCGCCTGCAAGGGCTTCCTCAACTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62