GenePrediction:GLEAN_8046 Details

Name: GLEAN_8046
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1421487..1418113 (- strand)
Length: 3375
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1421487..1421266 (- strand)
Length: 222
Type: CDS
Source: GLEAN
Position: GCSC_113:1421198..1420307 (- strand)
Length: 892
Type: CDS
Source: GLEAN
Position: GCSC_113:1420252..1420189 (- strand)
Length: 64
Type: CDS
Source: GLEAN
Position: GCSC_113:1420131..1419593 (- strand)
Length: 539
Type: CDS
Source: GLEAN
Position: GCSC_113:1419532..1419406 (- strand)
Length: 127
Type: CDS
Source: GLEAN
Position: GCSC_113:1419344..1419195 (- strand)
Length: 150
Type: CDS
Source: GLEAN
Position: GCSC_113:1418754..1418640 (- strand)
Length: 115
Type: CDS
Source: GLEAN
Position: GCSC_113:1418578..1418379 (- strand)
Length: 200
Type: CDS
Source: GLEAN
Position: GCSC_113:1418305..1418113 (- strand)
Length: 193
>GLEAN_8046 class=GenePrediction position=GCSC_113:1421487..1418113 (- strand)
ATGGCCGTACACCCACTTGCCGACCTGACGGCCGAGGAGGTGGTCCAAGCGGCGAACCTGATTCGGGCACAGCACCCGGG
GGCGCAGCTGGCCTTCAAGGCAATCACGCTCGAGGAGCCCGACAAGGCGTTGACGCTGCAGTATCTCGAGGCCGAGCATG
CGGGCCGCTCTGTGCTGCCGCCGAAGCGGATTGCCTTTGCGGCCTACTACATTCGGAAGACGGTGAGTGGGCAGTTGGCA
GTGGGATGCAGCATACCGAGGAAGCGTGGCCGCTAACGACAGGCGACAGACGGACTTCTTCACGGCGCTGGTCCACCTCG
AAGCCGGCGAGGTGGCGGTGACGAAGCAGACGGGCGCGGGTGAGCACGGCAACGTGGACTTTGCCGAGGTGCTGGAGGTG
GAGAAGGCGACGATGGCGTGTGCGGAGGTGCAGGCGGAGATTGCGCGGCTGCAGCTGCCGGAGAATCTCGAGGTCGTTCC
GGAGCCGTGGGGCTTCGGGTCGGACGGCGGTGAGGACGACATGACCCGGCTGTTCCAGGTGTACATGTTCCTGCGCGACA
AGACGGTGCCGGACAGCAACCACTACGCGCGGCCGCTGGCGTTTTCGGCCATCTTCGACCCGACAGCGATGCGGCTGGTG
CGCATCCAGCGCATCGCTACGGGGGCCGACCACACGATCGCGGCCGAGACGGCGCCATACAAGGTGAAGCCGGGCAGCGA
CTACGTGCCGGCCGCACAGCCGCAGCTGCGCACCGATCTGAAACCGCTGCAGGTGGTGCAGCCGTGTGGACCTAGCTTCG
ACGTCTCGGCCGACCGGATCGTTCGCTGGCAGAAGTGGGAGATGCGCGTGGGCTTCAACTATCGCGAAGGCGTGGTGCTG
CGTGACGTTCGCTACGACGGTCGCCCGCTCTTCTACCGCATCAGCCTCAGCGAGATGTGCGTGCCCTACGGCGACCCGCG
CTCGCCCTACCACCGCAAGATGGCTTTTGATCTCGGCGACGTCGGTGCCGGCATGGTGGCTAACAACCTGCGTCTCGGCT
GCGACTGTCTCGGCAGCATCGCCTACCTCGACGGGCTCGTCTGCGACCGCGACGGCCAGCCCGTCGTCATGCCCAACGCC
GTGTGCATCCATGAGCAGGACAATGGCATCGGCTGGAAGCACACAAACTACCGCACCAACAGTGAGTACAGAGTTTCGAG
TACCTGGCAGGCATGCAGAGTCGCTAACTCTTCAGACGCCTTTGTCGTTCGCAACAGAGAGCTTGTCGTCCAGACAATCC
TGACAGTGTCCAACTACGAGTGAGAACGGCTTTTCCTCTCCCCCAGATCAGAACTCACCCACCCTAACACGAACAGATAC
ATCCTCGCGTTCATCTTCAACCAGGCCGGCGAGATCGAGTACCAGGTTCGGGCTACCGGCATGCTGTCGACAACCGCCAT
TGACGAGGGCCTCAACGTCGACTTTGGCACCGTCGTCCACCCCGGCGTGCTCGCCTCCTTCCACCAGCATATCCTCTCGC
TTCGCATCGACCCGGCCATCGGCAGCTACACTGACGGCAACACCGTCGTCCAGCAGGAGGCCCAGCAGATGCCCATGGAC
GCCTTTAACCCCTATGGCAACGGTTACCGTGCTGTCAAGACCGAGATCGCCCAGGAGGGTGGCCACGATCTCGACTGGAC
CAAGTCGCGCGCCTTTGTCGTCAAGAATCCCCACATTGCCAACCCCGTCAACGGCCTGCCCATCTCCTACAAGCTCGAGT
TTCCGCCTGTTCCGACGCTGATGTCCCACCCGGAGAGCTACAACGCCAAGCGCGCCGAATTTGCCGACCACCACCTCTAC
CTCACAAAGTACCGTCCTGACGAGTTGTACTCGGGCGGCAAGTTCACCAACCAGAGTACGTATCTACCTGTCTGTATGAT
CTGATCTTTTCAGGCAGCCTGTCTAACTCTCCCAGGCCGCGGACACAATGGAATCAAGAGCTGGATCGAGAAGAACCATG
CCACCATCATCGACGAGGATGTCGTTGTCTGGGTCCAGTTTGGCCTCAACCACTTCCCTCGCATCGAAGACTTTCCCGTC
ATGTGAGTGCTCCTGCGCAGTTCCCAGCTCATTTTTCGGTTTTCCCACTGCTAATGCTCCCAGGCCCGTCGAGAAGGTCA
GCGTTGTCTTGCGGCCGGTCAACTTCTTCACCAAGAACCCGGCCCTCGACGTCCCACCGTCAAGCCAGGCCACCAACCAG
TCCGTTCTCGTCAGCGGAGACAAGACCGATTGTGCCAGCGGCTGCGCAAAACTGTAGACGGAAAGAAGTGCTTGCGCGAT
GATATATTGGGCGCCGATACTTGGTGATAAGATGAATTAAAAGCAAAAGTTAAAAGCAACTGCTCGTATCAATTAGTATG
GGATAAAATTATCTGTCTTTTGCCTCGCTCCGCATCTGGCTCGCGGCCTCCAGCAGGCGAGAAATATGGGCCTCCCAGAT
TTCATCCTAGCTTGTGAAGGCACCCTCGGCCTGTACGGTCGTCTCGGATTCAGGGAAGTCTTGCGAGCCATCAACGACAT
CAGAAAAGTATTCGGACTTATTCTGCAGAAGCTTAGACAGAAACAGAACTGTGATTGGCTGGCAGTCAATACCTGGAGCC
ACTCCAAACTCAACTACCCCGCTAAGTATTATTTGGACGTCCAATCTTGCCGAGTTCGACATGTGTTTTTCCACCTCTCG
CCAATAACGACAGCCGCACAACCGTTACGAAGCTCCGCAGCGAAGAGCGGCAGGAAGCAAGAAGCCCGCCACAGCAGCTG
TTGCCAACGGGACAGCAAAAAGAGGTCGCAGACATGCAGCGTCGAATGGTTTGTGCGCCGTCCTCCCCTGCTTCTGAACT
GCACCTCCTGACTGACTGTCGTGCTTCAGCTGAGCAAGGAGGAGGAGGAGGCCGCCGGGCCCGAAGTTGAGGTGCGCCGT
GAAGACCAGGAGAAGATCAACCGTTTCAGCCGGCTGCACCAGCGGGAGCTCAACCTGGAGGAAGAACTGAAGGCGAAGAA
CAAGGAGAAGGAAGAGCTGGACGACATCACAATGGAGCTGGAGCTCATCGATGAGGACGACAAAGTGCCGTACGTTTCCC
AACCCTCCTTTCTGCTTATCCTTCCTTTGCTTTCGCCTTCTCACACCTATGCCCTGCTACAGATACAAAATCGGCGACGC
CTTCTTCCAGGTAAGAGCAAATCAGGCACAGGAGATGGTCGGCATCGCAGCGGCGAAGATGGAGGAGAGCATGGGTGAGC
TCGAGGACTCGCTCGGGTCTATCCGCGAGGAGATGACCCGGCTCAAAGTCGATCTGTATGCGCGCTTCGGGCGGAGCATC
AACTTGGAGACATAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62