GenePrediction:GLEAN_8047 Details

Name: GLEAN_8047
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1407262..1405902 (- strand)
Length: 1361
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1407262..1407206 (- strand)
Length: 57
Type: CDS
Source: GLEAN
Position: GCSC_113:1407140..1406963 (- strand)
Length: 178
Type: CDS
Source: GLEAN
Position: GCSC_113:1406905..1405902 (- strand)
Length: 1004
>GLEAN_8047 class=GenePrediction position=GCSC_113:1407262..1405902 (- strand)
ATGTCGGCCTCTGCAACGGCTGTCGTAAATTCGAGTTACCGGCCACGATACATTGACGTGCGTGCGCATGAAATGTGCCG
AACTGGCAAAGGCCATTGCTTGCTGACGTTCCACCATGCCAGATCGGAATCAACCTGGCTGATCCCATCTTCCGCGGGCG
ATACTACGGCAAGCAGCGGCACCCGGACGATCTGGCCAGCGTGATCCAGCGTGCTCACGATGTCGGCTGCACCAAGCTCA
TTGTGACGGGCTCCAGCTTCAAGAGCTCCCGGGACGCTCTGGAGCTGACCCAAGAATTCCGTAGGCAGTCCTAAAGAGTC
CATTCCACCGTCTCCGCCGTGCTGACGTCTTTTCCAGCCGGCGTGGTTCTTGCAACAGCCGGCATCCATCCCTGCAGCAG
CGCCATCTTCGAGGCCAGACACCCGCACCATCACGAGGCCGACGACGACGAACATGTGGCGGCATGCGGTGCAGACCCGA
CACAGCCGCATGCCGACGACGGCGAGATTGACGCGACCAAGTCAGCCCAGATCGTGGCCGACCTCCACGCCCTGATCGAG
ACAGCACCCGCTAGCGCACTTGTTGCGTTTGGCGAGATCGGCCTCGACTACGACCGGCTGCACTACTGCTCGGCCAGCAC
GCAGCGGCACTCCTTCTCGACACAGCTGGCCTTGGCCGCCAGTCTGTCGCGTCCGCTCCCGCTTTTCTTGCACTCCCGCG
CCTGTCATGCGGATTTTGTCCGCCTGCTGAAGGAGCAGTTCGGGCCCCGGCTCGAGAGATTGGCCTGTGGCGCTGTCGTC
CACAGCTTCACGGGCACCATTGCCGAGGCCGAGGAGCTGATGGATCTCGGCCTGTACATGGGCGTCAACGGGTGCAGCCT
CAAGACGGCAGAGAACTGCGAGGTGCTCAAGGCCATCCGGCTCGACCGCCTCATGATCGAGACAGACGGGCCCTGGTGCG
AGGTCCGGCCGAGCCACGAAGGCTGGCGGTACTTGGTCGAGGCAGCCGAGGCGGCCAAGGTCCAGCATGCAGAGCTAGAA
GCCAGAGAGGAGCAGGTCCGGCAGGTCGAGCAGGTGCCTGCGACGTCAGCTACGGAGAAACGGACGCTAACACCCAAGAA
AAGCAAGCAGCCGCCGCAGCAGAAGAAAGAGCCAGTGGTGCCGGAACGGTTCAAGGTGGTAAAGAAGGAAAAGTGGGAAG
AGGGCGTCATGGTCAAGGGCCGCAACGAGCCCTGCATGATTGAGCGGGTGGCCACCATCATCGCAGCCGTAAAGGGTGTG
CCGGTGGAAGAGGTATGCGAGGCAGCATGGGCTAACACGATCAAGCTGTTTGGCCTGGAAGACACGGCACAACTCTCGTA
G

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62