GenePrediction:GLEAN_8048 Details

Name: GLEAN_8048
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1403290..1397024 (- strand)
Length: 6267
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1403290..1401223 (- strand)
Length: 2068
Type: CDS
Source: GLEAN
Position: GCSC_113:1401157..1400754 (- strand)
Length: 404
Type: CDS
Source: GLEAN
Position: GCSC_113:1400690..1400541 (- strand)
Length: 150
Type: CDS
Source: GLEAN
Position: GCSC_113:1400480..1400383 (- strand)
Length: 98
Type: CDS
Source: GLEAN
Position: GCSC_113:1399895..1397024 (- strand)
Length: 2872
>GLEAN_8048 class=GenePrediction position=GCSC_113:1403290..1397024 (- strand)
ATGCCCTCTGAGCACAGCAAGAGTGGATCCTCGACGCCAGTCGCCGAGCAGTCAGCCGTCGGAGACCGAGACAGGAGCGA
GGACCTGCAGGACGACGACGGGCACGACGACGGGAACGGCAGCGAGCAGCCGGCACGCAAGCGGCAGCGCGTGCGGCTGT
CCTGTCTGGAGTGCCGACGCCGGAAGCTATCATGCGACCGGGGCTTCCCGTGCGAGCGCTGCATCAAGTCGGGCACGCCA
GAGCGATGCACGTACGAGACGCGGCCAGGACTGGCGCCGCCGGCCAAGAACGGGCTGTCGCAGGGCGCGCTGACCAACTT
TGACTCGCGGCTGGCGGCCTACGCAGCCATTGGTGACGGCGGCATGATCCCGCCATACCGTCGAGACTCGCACCGGTCGG
CCGGCACGCCATCAAGCTCAACACAGCATCATGCCGACGTTGTGGGCGGTGGCAGCGACCGGATCCGGCGGCTCGAGCTC
GAGGTGGCCCAGCTGCGAGCCATGCTGACGCAGTCAGACAAAGACAAGAACGAGGGCAGCAAGGCCAAGACGGCAGCGCT
GTCCGACGGCAGCACGACGGTGCACGATGACGACTCGCCGGCCGACAAGGGTGACGGGAACGCGGGCCAGTCGCCGCCGT
CGACATTTGTCGAGCACATCTACGGGTCGGGCGGCGCGGCCACGACGCAGGTGGGCGACGAGCTGCGCTTCTTCCGCGGC
AAGGAGTTCAAGACGCGCTACTTTGGGCCGCACAACGCGTGCATGGCGTTTAGCGAGCTGACTGGCCTCTGTCCGTTCAT
GAAGGAGACGGCCGAAGAGTGGCTGCGGCCGCTGCATGTGCACCACTTCAAGAGCAAGGACCGGGCGAAACGGATGCACG
AGCGCGAAGACATGTTTGCACGGCCGGATGCCGAACTGGAGGCACTGTTGCCATCACGTGACGAGACAGACGTGCTAGTG
GACATCTACCTCAACCAGTTCGAGCAGGTGCACCGCATCATGCACATTCCCAGTTTCCGGCGCGACTACGCGTCGTTTTG
GGACGGCCAGAAGACCCGGCCGTCGGCCTTTACGGCGCTGCTGCTGTCGATGATGGCCATCTCGAGCTGTCTGCGCGGCA
ATCCGACCGGCCGGTTCGTCGGTCTGGTGTCACAGTCACACTACATGGCCGAGCAGTGGATCGCGGCCTGCGAGGCCTGG
AGCCAGCGCCAGAGCCAAAAGCACCGCAAGCTGGTGCACTACCAGGTCGCCTGTCTCGTCTATCTGGCCAAGCGCGTCAA
CACGGTCAAGAAGAAGCGCTTCTGGAAGGCGTCGGGTGCGCTGGTCCAGGATGCCGTCTCGGTCGGCCTGCATCGGGACC
CCAGCCACATCCACGAGAACGTGTCGGCCTACAACCAGGAAATGCGTCGGCGTATCTGGTCGACCATCCAGGAATTCGAC
ATGCAGGCCTCCTTTGATCACGGCCTACCCACTCTGCTGAGCGCCCTCCGCTTCGACGTCCATTCGCCGCGCAATCTCGC
CGACGAGGACTTTGACGAGGACTCGACCGTGCTGCCGCCCTCTCGACCACCCGACGAGTATACCTTCTCGTCCTATCAGC
ACCTCAGCCGTCAGAGCCTCGAATTGCGTCTGCAGCTCAGCCGCGTGCTCACCGGCCCGCCCGACGACCTCGATTACGAC
CAGGTGATCCGCTACACTAACGACATCACCCAGGAAATCGATGCATTGCCCTCGTGGGACGTCCGTGCCATTGCCGAGTC
GCAGGCCAAGGCCAGCCCCGACCGCGATATCCTCACTGCCGCCCACCTAACCCCCCTGCTGGCCTACACCCTCCTGCACA
TCCAGCTGCGCCAGTACATCATCCCGCTGCATCAGCCGTATCTGAAGCTGCGCAAGACCAACTCCAAGTACCAGTACTCC
GAGATCATCTACTACAACGCTGCCCGCGACATGGTCCTGCTGCACGATAAGCTGGCCGAGCAGGGTGTCCGCACCCTCAA
CTTCATGCGCGAGGACGCCCTGACGCTATCCATCAACCTCTGCAGCGTCACCATGCTCCAGCCTAGAGGTACGTCTGACC
CCATTTCACCCCCTTGAGGTTCGTTGCTGACTCATCCTTCTCCCCTCCCCTAGGCTCTACCAATATGATCATGGTCAACT
CGCAGCATACCATGAGGCTGCTTGAAAAGTGCCTGGCCATGAAGGAGGACCGCGTGCTCCGTTGCGGCAATAACGAGCCG
TGGGGCTACTCCATCATGTGCGCTGCCACCGGCCTACTGGAGGCCCATCTCGGCCAGAAGACCCCCGAGGCTGCCAAGGC
CTCGTCTGCCGAGCGCTTCGTCAACCTGCACTGCAAGCTGCTGGTGCGCCAAGATGGCCCGCAACAGCAGCAGCAGGACC
AGCAGGATGAACCGGAACGGCACGAACAGCGCCAGGCACCACCACTTTTGCAGCCACAGTTGCCACAGTCGCTGCTCGCC
CCTCCGGCAAAGATGACCATGGGCATCCTGGGAAACGAGGTGCTGGACCGGCCAAAAGTCAGTTCCGTCCATCATGGTCG
CAGCAACGCAGACATGCTAACGCCCTCTTCGCTCCCGCAGCCGACTGCCCCTTTCTTTTCCATGTCACAGGGATCTAGTC
AAGGCGGCGGCATCGGTATGGGCCCGGATGCAATCCAGCCGACGACTGCTTGGTGGATGGCCAACATGGCCAACATGGCC
AGCATGGCCAATCCCAATGCAGATGCTTCGGTATGTCGCCGTCTCCTCCCACAGTCCGCCCGCGCTGCGTCTCACTAACA
ATTTCCATAGCAAATTCAAATACCCCAGGGCTTGAACTCCGAGTTCAACGTCGAGCTCATGGGCTTGAGTCTCGGCAATC
TCTGGGCCGATTACTCGTGGGAGGAGACGTGATCCTCGGCGTAAAAGGGCCTCGTCACGTGTTGCATGTTAAGCCTTGTG
AAAATAATAAAACGTCCCGGACGGGCGTGCCTTCTGTCCCAGCTCAGCCTTTCTCTTTCCATTTTCGTGCATGTGAGATA
GAAATGACGATTTATAATTGTCCATGCGCGCTTCCCTCGACTGTGATGGAAGGTGCAGGGGACTTTCGTAGCCAGGTTGT
CTGTGTCCGAACCTGGAAGGAGCGAGGCAAGCCCATCGCCCTGCGTTCGTTTATGACGCATCCTCCCCTCTTCCCCCCCC
CAACTATCGTGACCCAAAATCTCTTTTGGCCTTTCAACCGGTTCATCTACCTCATTATTGGCAGCGAGGCAGCTTCTCTA
TTAACGTTCGACTTCCAGCAAACTGGCATTTTGGCCAAGAAGCCGGTCTGCATGCATCCATCTCTTCTTTATCCCGTCAT
AACAAGGTCGCACTAGTCATGTTTTGTTTCTGTAGCAAAGAGCCCCGGGAGGGATCGTCCCTTCACAGCCGGTCCTCTGC
AACGTCACCCGCAGCTGCTTCTCCCACCAGAGCACCGCGTCTACCCGCTCCGCATCTTCTTGCAGAGTCTTCTGCGCCCA
TCTTGTCCGATTTTCATTCCTGTGCCGACCCCAGACAGTCCCGCCCAGCCTATCTGATCCCCAAGATTCCCGGACTCGAG
GGACTTGTGGACAACGATACCGACAGCGACGATGGAGTGCCTCATATGACAAGTGCCGGCACCGTCTCAACTTCCGCCGG
GCCGGCAATTTCCAGGAGTGCATGTAACAGCATCAAGGGGTCCGCCTCGAGCCCTCTGAGCTTGCTGAAAACCCATATGG
AAGCACTACGGCATTTTCCCTCTTCCGAATCCACCCGCAGTCGTGCTCTAAGTGTCGCCAGTGATGAGGATGACTTTGCT
GCTATGGCCCGAAGAGCAGAGGTGCGCCGCATAGCGCACAAAATGATCCAAGAAGAGCTCCAGAAAGAACAGCATCCCCC
ACCAACGCACTCGCATCGAAGAGTCGCTATGTCAACCATCAGGGAGGATCCTTCAGATGTGGCTAGCTCGTATGGAGGCC
CCAGTCGCAATGCCAAGAACTCTTGCAACAGAGCCACTCAACGAGACGGCCAGCATGTGGTTATCGAAAACACCAGTTTT
GGCTGCAGTCATATCCAGGCTGATTTCCTCCAAAAAGCAGACGGAGGAACTCCTCTATTTCCTGAGGAAACCAACTTGCC
ACGCACATTCCAGCTGAAATCCCGGTCTAGAATTTCTTTGCCTCGGGGCTTCAGAATCCGAAGCCGGATCCGTGGAGCTG
TGGGGGAGAAACGCTGGGGAAAGGCCACGTTGGTGACAGTTCGATCCCGACAAAGCTCGGAAGTCGCTGCACTGGACGAA
GAAACGGCCGTATCGCCTTTGCAACCAGTCGACCAAATTAGCGAGTCCCTAGGTGTTACTAGGAAGAGACCATCAATCGG
TTGTGAAAGCTGTTTCGTGTCCCTGCTGGGCGGCGCCTCCCTGGATGATTCTCGTAAGAATACAACTGTTTCTTCGGACC
AACGTGCGATTGGAAATGCCAATGGAACATTTTCTACCGTTCATGTGGAGAACACCAGAACTGCCTGTCCTGAACACAAA
CCTACTTCTCGCCACGTCAGCTATGTTTCTGAGTCGCTGGGGTCGTATGATGAGGACGGAAGCATCCATGAGGCTCACGA
AGCGCATATCGTTGCAGCGAGCAAGCCTAGCAGTCCCACCCTATGCATATGTGGCAGCTGCGGAAAAGGGCAACAGCCAA
TGCTCTCAGACGGCCCAGAGTCACGTTCATCCTGCCACCTTTGTACGGCAGCCAGCACGCATATTCAAAATGGGGAGCAC
AGGAGCGGCCCGTCGGTGGCATCTCACATAAGCACACTCAACTTGCCATCTCCAGTTGTGGAGCTGAACTCTATTGTAGA
TGGAGGGAGATCCCTGAAATCAAGAAAAGACAGTCAGAGCTGGACGACTTGTAGGGATTTCCCCCCGCTGAATGTGAGTG
ACGACGATAGCAAAAGCTTCTCAGAGGCAATTTCACGAAGAAGAAGCACGGGATTTCCATTCCAGTTCCGCTCTCTCAGC
CGTAAGTGGCCTCGTCAGTTGTGTTACTGCAATACATTGAAGCTAACTCCAAACTCAGGACTTGGTGGATCGAAAGCCTT
AAAAGACATCGAATTAGATGAAGATTTGCAGCCTACCGCACCATCAGGACATATGCGGAGTAGATCCGTCGACACCCGGG
GCTTTCCGGAATCTTGGTGGAACGCAGTACCAGACATGCCGACTGAGCCCAAGCATGCCACTGGTGCCAACACGTCTTCC
CCTGATGGGGTTCTCGAAGCCCAGCCACTGTCCGTGAACACTCTAGACAAAGCCGACATAATTGTAGCGTCGGAGAAGTC
TGTCAATGAGCAAGGCGGGCTCATGTTTCTTTCATCGAGGGTGATGTCAGCCAGTTTCGAAAAGGTTTTCAAAATGGGCC
TCAACAAGATCATGCCGCGAAGACAGAGCGTCAGCGTGACCCAGACGCAGGATGACTCCGTTCCTACGTATTCATCTCAA
AAGCTTGATGCACATGTCCCGGATGGCGTTCTACAGCCACATTTTAACGTCATGGATGAGAGCGTCGATACCTTGCCGGT
CAAGCTGCCTCCACCTGGGCCAGAAACGGAATTGCCAAGAATTGAGCGCCGGCTGTCAGAGGCTTCCATGTCAACTTGTC
CCAACCGGAGCCAAGAAGATATGATAAGCGATATTGACAGCGTTTTCGGTGTATTGATCAGCGCGGACAATAGTCAAGAC
AAGGGAAGACAGACGCCGGTAAACGTCAACATGGGTGTTGTGGCAGACAAGTCTTGGCCCCCTCTGACAGCCCCATCGAC
GCCAGTCTCCAACGCTTACGCAGAGGTTCGCGCATATATTATCACCAACTTTTCCGAGAACACGGCCATGGCTGCTACGA
AGAGAATAGCCAAGTCCAGCGGGGGTTCCGAGAGCTGTGAGCCTGACACTAACCAGCAGAGCGGCAAGTCCTCCGTGGAC
ACAGCCCCGGTCCCCGAACCTAAGGCTATTCGCGGAGATGCCATCTCTATCAAGAGTGATAGTGCGCATGTTGTGAAGAA
GCCTGGCACGTCTTTGGCATCGTCCAAGTATATGACCTGGAACTGTCCAACGAGAGTGCCACAGGAGCCAATGCGCAGCA
CTCTTGAATTTGGACTGGAGCTGGAGCGGGTGCTCAGCGGAGAGAAAGAAAACATGGAGCTATTTGCGGGTCGAGCAAAG
TTTCCAATCATCAAGTATGGCCAGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62