GenePrediction:GLEAN_8049 Details

Name: GLEAN_8049
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1382879..1381857 (- strand)
Length: 1023
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1382879..1382834 (- strand)
Length: 46
Type: CDS
Source: GLEAN
Position: GCSC_113:1382767..1381857 (- strand)
Length: 911
>GLEAN_8049 class=GenePrediction position=GCSC_113:1382879..1381857 (- strand)
ATGGCGCCCCGTATATCGTGTCCGCAAGGGCTGGCCGTCCTGAACTGTAAGAATAGTCATCTTCTCATACCTTTTATGTG
CCAGGCCGAGCGGAGCTGACGCTTGCCGATAGTGTGCCTTCGTCCGGCTGCGAGACGGCCGACCCCGAGCCTGCAACCGC
TGATCCAGACGGCCAATCTTTCGCAGAAAGAGAAGAAGCGGATGATGAAGCAAGAGCCTTACAGATGGGCGCAGATACAG
GCGCGCAAGGCCGCAAAGGTTGAGCGACAGCAGGAGATCCAAGGCGCACGCGACGCTGCATGGGGCAGTCCCGTGCACGG
CATACCGACGACTTTTGTCGAGTCGTTCGACTCGGCCGGTCAGAGACCAGTTTCTACCCCACCCAAGCCGAAGGCTGGGG
AAGTACCGGAAGAGCCGCGCGCACTGCCGACGTCTCCGGAGATCCTCAATCACCAATTGTCGCGGACGGAGCTCGACGAG
GCCATTGCCATGGCATACCAACTGAGCAAGCCTTTGGGGAATGCTAACCGCATCGTGGTCGACGCCGTAAGCGAGGCACA
GGAGCTACGAGAGCATGAGGAGCGGCATGAGAAGGCTGTGATCGCGCTGCAGCGCATTACGTCGCTTGACAACGCCAGCA
GCAAGGGCATCAGACATGCCAACATTCGGCGGTGCATAGAGTCCTTTGGTCGCCACAATACCGACAACGTCTTGCGGCCA
AAGCCTCGGGCTCCTGGATTGCCACCGCGTGAACATCTTCAACGGGGCGGCCCGGATACGGGATCTCCAGAGGTTCAGAT
CGCCATTCTGACGGCAAAGATTCGCGTGCTGGCTCGGGCTTTCGAAGGCAGAAAGGGAAACAATGACAAGTTTAACCGGC
GGAACCTGAGGTTGCTGTGTCACCGACGGCAGAAACTGATGAAATACTTGGAGAGAAAGGAACGTGGAAGCGAGAGGTGG
ACGAGCTTGATCGAGACTCTGGGTCTGTCGCCTGCCACCTGGAAAGAGCAGATTTCTGTTTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62