GenePrediction:GLEAN_804 Details

Name: GLEAN_804
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_132:89432..90203 (+ strand)
Length: 772
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_132:89432..89981 (+ strand)
Length: 550
Type: CDS
Source: GLEAN
Position: GCSC_132:90049..90203 (+ strand)
Length: 155
>GLEAN_804 class=GenePrediction position=GCSC_132:89432..90203 (+ strand)
ATGGAAACAAAGGTGTTTTCGAGCTCGATTGCGGCGAAGCCGTATAGCTGGCCACACGACGCCTCGTTTGGGCCAGAGAA
GACGGCACTGGTGGTGATTGACATGCAGGTGGACTTTTGCGCGCCAGGCGGCTACATGGACAGCCAGGGCTACTCGATCG
AGCCGGCGCGGGCGGTGATCCCGCGCATCCAGGCGTTGTTGGCAGGCTTCCGGACGGCCGGCTTTCCGATCTACCACACG
CGCGAGGGCCACCGGCCGGACCTGTCGACGTTGTCGTCGCGCGAGCTTCTGCGTAGCCGCAACAACGAGTCGGGTCTTGG
GATCGGCGACATGGGTCCGATGGGGCGGCTGCTAGTTCGCGGTGAGCGTGGCCACGAGATCGTGCCGGAGCTGCAGCCGC
TCGCCGATGAGCCGGTGGTGGACAAGCCTGGCCGCAGTGCGATGCAGTACACGGACTTGAAGCTGCTGCTGGACAACCGT
GGCGTGCGCAACCTGGTGCTTTGCGGCGTGACGACAGACGTGTGCGTGACGACGACGATGAGAGATGCCAGTGAGTGTTT
CTGTTTTTGTTTATCCTCTTGTTTCTTTCTTTTCCTCTCCTCTCACACCTCATCTAGACGACATGGGAATGGACTGTGTC
ATTGTATCGGACGCGTGCGCAGCCGGCCGGGAGGACCTGCACGACGCAGCCTTGGCTAGCATCTGCGAGGAGGGAGGCAT
TTTCGGGGCCGTGACCACGACAGCGGACTTGCTGACAGCTCTGCGGGGCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62