GenePrediction:GLEAN_8050 Details

Name: GLEAN_8050
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1379882..1377836 (- strand)
Length: 2047
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1379882..1379848 (- strand)
Length: 35
Type: CDS
Source: GLEAN
Position: GCSC_113:1379751..1379662 (- strand)
Length: 90
Type: CDS
Source: GLEAN
Position: GCSC_113:1379555..1378177 (- strand)
Length: 1379
Type: CDS
Source: GLEAN
Position: GCSC_113:1378119..1377836 (- strand)
Length: 284
>GLEAN_8050 class=GenePrediction position=GCSC_113:1379882..1377836 (- strand)
ATGCCTCTCTTCGTCCTCGCAGAGACAAGTGCAGGGTAAGTCCAGGCAGTCGCGATCGACTTCTTCGAACTCTGTCCCGA
CGAGGGCACTCTCTGTCCCGTAACCCTTTCCTAATATGATGTCTTTTACAGCTACGGCTTGTTCAAGGCCAAGGACAAGA
AGCTTCTTGACCGTGACGACCTAAGCCTTCGGATATCCACCACCGAAAAGATCCACGACGAGTAAGTTCATGCCAACCAC
CCTTTGTCTCTTGTCTTAAACACCCCGGGCCAAGCAAACATTTTTCCACAATGGAACAAGCAATTGTACTTACAGCACCC
TCACCAGGCTTAAGCTTAAGGAGTTTCTGAAGTGGGACAGCGCCTCGGCTGCTATCAACGAGCTCGATGGCCTCATTGAT
GGCAAGGTGCCACCTTTGCTTGCAAAGTTGCTGGAGAGCGTAAAGGACGAGAAGAAGTTCTCCTTGGCCGTCGCAGATAA
GGGACTCGGAGTGTCTCTGTCGAAGCTTCCTGGATTCAACATTACTGCAGTCACCGCAGCTCCTGGCTCTGTGGCCGGTG
AGGTGTACCGCGGCATTCGCGAGCACTTGACCGATCTCATTCCTGGCATTGACGATGCCGGCTTCACGACTATGGCTCTG
GGTCTGTCCCACTCGCTTTCTCGTCACAAGCTCAAGTTCTCTGCCGACAAGGTTGACGTCATGATCATCCAGGCTGTCGC
CCTGCTCGATGATCTGGACAAGGAGCTCAACACTTATGCTATGCGTGTGAAGGAGTGGTACGGCTGGCACTTCCCCGAGC
TGGCTAAGATCTTGAACGACAATCTCGCTTACGCCCGGGTAATCATTGCGGTCGGCATGCGTGACAACATCCTGGACGCC
GATCTGTCCGAGGTTCTGCCGGAAGAGATCGAGGCCGCGGTCAAGGCAGCTGCTGACGTGAGCATGGGCGCTGACATTGC
CGAGGAGGACTTGGAAAACATCAAGCTCCTGGCCGAGCAGGTAGTTTCATACACGCAATACCGCGCACAGCTTGCCAGCT
ACTTGGAGGCCCGCATGAAGGCCATCGCACCTAACCTGACGGAGATTGTTGGATTCCTCGTCGGCGCTCGCCTCATTGCT
CACACCGGCTCGCTCATGAACCTCGCCAAGAGTGCCGGTTCGACCATTCAGATTGTTGGTGCCGAGAAGGCCCTCTTCCG
TGCTCTCAAGACCAAGCACTCGACCCCGAAGTATGGTTTGATCTACCACTCGTCGCTCGTGGGCCAGGCAACTGGTCGGA
ATAAGGGCAAGATCGCACGTCAGGTGGCCGCAAAGGCTGCTATTGCTGTGCGTACTGACGCTCTCGCCGAGTTCGAAGAC
GATGCCGATGATGAGATTCGCGCCGCCCTGGGTATTGCCGCGAAGGCCAAGCTCGAGATGAACCTGCGGCGCCTAGAAGG
CAAGCCATTGACCAAGACCCTCACCATCAACAGCGTCAGCGAAGCACCCGGCAAGTGGGAAGTCAAGGAGGCACGGAAGT
ACAACATCGACGCCGATGGTCTCACTGGCGATGAACCAGCAGCAGCTGCAGAGAGCACTCCGGCAAAGAAGGAAAAGAAA
GACAAGAAGGAGAAGAAGGACAAAAAAGAGAAAAAGAGCCTACCAGCACCGGAGAACTCGGACGACGAGGAGCCGGCTAC
GAATGGCACCACCAACGGCGCATCAGGTAAGACTTGGACTTCGCCTCTATGCATACAGGTTCAACCGCTAACTTTATGAC
TAGCACCACGCAAGCTTTCCGAGGAGGATTACGAGCGCCTGGCCGAGGCCGCTGGCATCTCAGTCAATAAGTTGAAGCGC
AAGTACGAGCGTGGTGACGTCGAGGTTGACAAGAGCGGTAACCCCATCGTACACAGCAAGAAGGAGCTGAAGAAGCTTCG
CAAGACCGAGAAGAAGTCCGAGAAGCCGAGCGAGGACAGCGATGAGGCCGCTGCACCGAGCAAGCGGAAGCGTGATGACG
AAGGCGAGAAGCCCAAGAAGAAGAAGAAGAAGAACCACGAGGCATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62