GenePrediction:GLEAN_8051 Details

Name: GLEAN_8051
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1377330..1376507 (- strand)
Length: 824
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1377330..1376772 (- strand)
Length: 559
Type: CDS
Source: GLEAN
Position: GCSC_113:1376709..1376507 (- strand)
Length: 203
>GLEAN_8051 class=GenePrediction position=GCSC_113:1377330..1376507 (- strand)
ATGGGCGACACCGAAGCGGGAAACCGTTCCAGCGGTAGGCCGAGCAGATCGGATCGCAGTCGTAGTCGCTCGCCCCGACG
ACGAGACGACAGGCTAGATCGAAACCGCGACTCCAATAGTGAGCGCTTCCGTGAGCGTGATCGCGACCAGGACCGAGGGC
GAGACCGAGACCAGGATCGTGACCGGGATCGGGACAGGCCGAAAAAAAAGAGCGGTCGGGGCTTCAAGGTCAAGGAGAAG
CGTCAGGACGAAGACGATGGAGAGAGAGCTCGAGTTCGCTCGCCGCGCCGAGACAGTTACCGCGACGGTCCACGGGACAG
AGAGCGAGAGCGAGAGCGAGATCGCGAGCGGGATCGAGGTGGGGATCGAGGCGGGGATCGAGGCGGAGATCGGAGCAGAG
ATCAAGGCCGTGGCCAAGGTCGTGACCGTGATCGCGGACACAACCGCGACAAAAAGGAGAAGACCGATTCTGGACCAGGC
GCCAGTGCCGCTAAGAAGAAGACCATTGTGCCTACCGCCAACCAGGAGTTCATGATCGTGCACGTGAATGATAGACTGGG
TGAGTTTAAGCTTCGAAGCTGTTGATGTTCTGTTTGTGTTTGCAGTTGCTAACAGCCGCAGGCACCAAGGCGGCGATTCC
ATGTCTTGGTTCAGATCTGATCAAGCAATTCAAGGTCATGGTGGCGGCACGCATCGGACGAGACCCGAACGAGATCATGC
TGCGGCGGCAGGGTGAGCGGCCGTTCAAGGACCACTTGTCGCTGGACGACTACGGAGTCAGCAACGGGGTACAGCTGGAC
CTGGAGCTGGATACAGGTGACTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62