GenePrediction:GLEAN_8053 Details

Name: GLEAN_8053
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1370698..1368944 (- strand)
Length: 1755
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1370698..1370404 (- strand)
Length: 295
Type: CDS
Source: GLEAN
Position: GCSC_113:1369551..1368944 (- strand)
Length: 608
>GLEAN_8053 class=GenePrediction position=GCSC_113:1370698..1368944 (- strand)
ATGGCCTTTGGACGCCGCGGACCCAACATCTCGCAGTTCCTGCGCGAACTGCACGAAAACCCATCTGTACTGGAGGACTC
GTTCCCAACGGTCGACGACCAGGACCTGTCCATGTTCACCAACACCGAGTTCTATGATCTCGAGACTGGTCAGAACACCG
ACTTCCAGCCTCAGCCGTCCCAGCCGTCTAAGGTCACAACCGACGGCGGGTCGCCGTCGGATGCTGTCACTCCTGTGTCC
GAAGAGACGGCTGCTGCCATTACCGATTTTAACAGCCTTGACTTCATCGCTACAGGTCAGTAACTTACAATGCTTTTCAC
GTCTCTTTGGATGTTCAGGGACTTCTTTCCCGGTCCGTCTTGTCTCGAAATTTTTGAGATCGAGACGCATATTGTCGGTG
CGGCGTGGTTCTCTTTACAAGTGTTTCAAGAGTGGCATTTTCACCTAGACCCGGATGGCAACACCGGAAAACAGCAAACG
GCAATTTTACCGAAGCAATGGGATTATTTCTATCGAAATTCTCTACCGAATCACATTGGTAGCTGTTGTTTCTACCCTGT
CGAATCATCATCACAGCCTGCATTAATCTTGTTGTTTCCCGTTCTTCGAGAAGATCGTCGGTTCGCCTTCCCCACTTGTA
CTATGCATGTCTTGTTATTTCTTTTGGGGGGGTTTCTTTAAACGTTTTAAATTGGAACGTGTTGCTGTCCATGTGGCCAG
CATCCGTTCTGGTGGAGGGTAGAGCGACTAAATGGGTTGTGCAAATTGCGAGCTCTGATGGTGCAATACCCCGTGACTTG
TGCTCATCAGCGCAGTCCAGAGCTACCCCCCTTCTCATCTGCCAGCCCGGGAGTTCAGCAATTCTGGTAGGCATCCGGAC
CAGCTAGGGAGTTACTCTCGATATTTCTCTTTTTAGGCTTGCTTACCTTCTATTTTGTCTGCTTCTTATCTGCCCTTATT
TTTGGATTTCTTTAATTGTTGCATATCGCACATCACCCATATTCTTCCTACTACTTACACGTCCGATTGCGTCCCAACTC
TCGTTTTTTCGCATTCTATTGGGCCATTTGCCGCTGTTCTGGGGCTGCACCGGCCATGTTATAAGCCTCTATGCGAAAAC
TTACTGACCATGGCACAATGGCCTCAGGCGATTTCAACTTTCCGGATTTTGGCGCTGCCTACCCATCGCCGTCTATTCCG
TCCTACCCGGACAACTTGGGGAGCCTCCAACCCATCCAGCCTGGCCCCCAACATGGTTATCAGTCCTCCAGTCCTACTGG
TCAAAGCAGTGGGCATCACAACAGCTATGGCTCCAGCCACCAACCGCCGCGGATAGCCGCCGCGGATAAGCGCAAGCCGG
ACGTTCTGAACCATTCTACACGTGCCATGTCGTTCGAAGAGCAGACCCGACTAGCCGCCGAGGAAGACAAGCGCCGTCGA
AACACGGCAGCCAGTGCCCGCTTTCGGGTCAAGAAGAAGCAGCGGGAGCAGGCACTTGAGAAGTCGGCCAAGGAAATGAC
CGATAAGGTGACGGCACTTGAGAACAGAATCTCGCAGTTGGAGACGGAAAACAAGTGGCTCAAGGGCATTGTTTTAGAAA
AGAATGCCGGAAACGAAGAATTTCTCGGCAAGCTACTGGAAGACTTCAAAGCAAAGCACGCCAAAAAGGCGAACAGACGT
GGCGATGCAGGGAGCGACACCTCCTCCTCAGGAATCACAGACGAGGAAAACGAGGCCCGGGACTCTTCCGGCTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62