GenePrediction:GLEAN_8054 Details

Name: GLEAN_8054
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1362299..1360906 (- strand)
Length: 1394
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1362299..1361936 (- strand)
Length: 364
Type: CDS
Source: GLEAN
Position: GCSC_113:1361819..1360906 (- strand)
Length: 914
>GLEAN_8054 class=GenePrediction position=GCSC_113:1362299..1360906 (- strand)
ATGTCTTCCTCCGGCACCGCCAACGACGGCAACAGCCACAGCGGCAGCGGCAGCATTCGCAAATCCATCATAGGTTCGTT
CAAGAGATTCTCGAGAAAGGCCAGCTATGAGGGCGAGCCGACAGCAAGTCGCCCGTCTGGCGGCAGCGGAAGCTCATACA
ACCATGGCGCCACCAGCAGCACCGCTGCTCCTGCTGCTGCATCCGTTGTCCCCCGCAGTCCTGTGACGGGCCCACGCCCA
GCCGATCAGAACGACGGCTTTCTCGCAGCACCTTCTGCAGAAACTGCTCGCGAATTAGCCAACAGACGCGATAGTCAATC
ACGCAGCCCTCTCGTCAATCCCTCGCCGGCTACCCGTCGTCCTGGTAAGCTCAGAATGGAGATGCGGGACACAGACACGG
ACAAACGTGCAAATGGCATATATGCATACACACACACACACACACACGCACACGTACTGCTTGCTAACCAGATACTGCAG
CCGGAGTCAATGATCCTCCTCCTCCTTACGAGGCCGTCAACACGGTCTCACCCACGACTGCCAGCGCCAGTGCAGGTGGT
CGTCATCGCCCGGCGTCGCTGGCTCCCTCCACCCGGTCCAACATCTCCCGTCTGACGGTCAACGACATCACGACTGCCGA
GGACCGCTATGCCTTCCTGTCGACCTTTGACACCATCTTTGTCATTGACGACTCTGGTTCCATGGCCGGCCGCTCGTGGC
AGGAAGTCGGCGCCGTCCTGGCCAACATTGCCCCCATCTGCACCACGCACGACGCCGACGGCATCGACCTCTACTTTTTA
AACCACAAAACACCAACCACGGCTGCAACGCCTCCTGGCAAGGCCACCGGTGGCTACTCCAACGTCCGTGATGTCGCCAC
GGTGAACCGCATCTTCGAGACCGTCCGCCCCGGCGGCTCTACCCCGACCGGCACCCGCATCAGCAATATCATCCGGCCGT
ACCTGCGCTACTACCAGCAGAAGCTACAGGAGAACCCGGACGAGCCCGAGTTGAAGCCCGTCAACATGATCGTCATCACC
GACGGCGAGCCCAGCGACGACCTCGAGGGCGTCCTCTACCACGCCGCCCAGAAGCTCGACTCCCTCGATGCGCCGCCCTT
CCAGGTCGGCATCCAGTTCTTTAAGGTCGGCAATGAGCCCGGCGCCTCGGAATACCTGCGCACCCTCGACGACCACCTGA
GCGAGCTGGTCCGCGGCCAGGGCGTGCGCGACATGGTCGATACTGTCACCTGGGACGCCTACATTCAATACACTGGCGCC
GGTCATGCCGCCCTGACCGCTGACGGCATTCTCAAAGCCGTGCTGGGAGCTGTAGTCAAGCGTCTGGACCGCCTTCCCAC
CGGACCTGCACGTCCGCCCTCGGCTGGTCGATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62