GenePrediction:GLEAN_8055 Details

Name: GLEAN_8055
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1350255..1346635 (- strand)
Length: 3621
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1350255..1350129 (- strand)
Length: 127
Type: CDS
Source: GLEAN
Position: GCSC_113:1350068..1350056 (- strand)
Length: 13
Type: CDS
Source: GLEAN
Position: GCSC_113:1349992..1346635 (- strand)
Length: 3358
>GLEAN_8055 class=GenePrediction position=GCSC_113:1350255..1346635 (- strand)
ATGGCAGTCATAGACGACGGCTTCGAGGCTCTCCTCGAGCCCTTTTACAATGGCAAGAAGCTGACGGACCCCATCTCCAC
CAAGGACGACAAGTATCAGCTACTACCGGCCTTCCTCAAGGTGAAGGGTGAGTTTTTCGGGGGGAAAGCTGGTGCGTAAG
AAGAAAACTGACATGGGTGATCTGCAGGTCTCGTGAAGCAGTAAGTACCGAGGGAGAAGACAGGAGCTGGCGGGATGACA
GCTAACGAGGCTGTTCTGTGCAGACACATCGACTCGTATAACTTCTTCGTGGAGCAGGAAATCAAGGACATTGTGACGGC
CAACCGGACGATTCGCAGTGATGTGCAGAGCGGGTTTTACCTCGAATTTACCGACATCCGGGTGGGACGGCCGACGCGGA
CGGACTTCAGCGACATCAAGTCACAAAATGAGGTGACACCGATGGAGTGCCGGCTGCGCGATATGACGTACGCGGCCCCG
ATCGTGGTGGACATCGCATACACGCGAGACAAGAAGCGGATTATCCGGCGCAACATCACGCTAGGCCGGATGCCGGTGAT
GCTGAAGAGCTCCAAGTGTTGCCTGAGCGGGGCGACGAATTCGCAGATGGAGGTGATGAACGAGTGTCCGTTGGACCCGG
GCGGGTACTTTATCGTCAACGGGACGGAGAAGGTGATCCTGATCCAGGAGCAGCTGAGCAAGAACCGGGTGATTGTGGAG
TCGGAGGAGAAGAACGGAGTGATCTCGGCGTCGGTGACGAGTTCGACACACGAGCGCAAGAGCAAGACGTACGTGACGCT
GAAGAAGGAGCGAATTGCATTGCAGCACAACGTGCTGGTGGACAACATACCTATTGTGATTGTGCTGAAGGCGTTTGGTG
GCCTGACGGACTACGAGATCATGCAGCTGGTGGCCGGGTCGGACGGACGGTACCAGGACGACTTTGCGATCAACTTTGAC
GAGGCGGCGAAGATGGGAGTGTTTACGCAACAGCAGGCGCTAGAGTACGTGGGCGCGCGGGTGAAGATGGGGACACGCAA
CGGCGGAGGGCCGGGCGGTGGGCCAGGAGGGATGCGGCCGATGGGGCCGCCGACGAAGCGCAACAACGTGGAGGAGGGAC
TGGACGCGCTGGCCAACATCATCATCGCGCACGTGCCGATCGATGGGCTGGACTTTTTCCCCAAGGCGGTGTACGTGGCG
ATGATGGCACGACGGGTGTTGATGGCGATGCACAACCCACAGCTGGTGGACGACCGGGACTTTGTGGGCAACAAGCGGCT
GGAGCTGGCGGGACAGCTGCTGTCGCTGCTGTTTGAGGACCTGTTTAAGAAGTTCCAGAGCGACCTGCGCTTTAACATTG
ACAAGTTTTTCAAGAAGCCGCACCAGGGGGTGGCATTCGACCCGCTGACGTCGATCAGCGCGACAGGCCATCACATCTCG
CAGGGGATGAACCGGGCGATCCAGACGGGCAACTGGAGCGTGAAGCGGTTCGGAATGAATCGGGGAGGCGTGACGCACGT
GCTCAGCCGGCTCAGCTACATCAGCGCGCTGGGAATGATGACACGGATCAGCAGCCAGTTTGAGAAAACGCGCAAGGTGA
GCGGACCTCGGGCGCTGCAGCCGTCGCAGTGGGGAATGTTGTGCCCGTCGGACACGCCGGAAGGCGAGGCATGCGGGCTG
GTGAAAAACCTGGCGCTGATGACGCACATCACGACGCACGTGGAGGAGGGTCCGGTGCGGGCGTGGGTGTTTTCGCTGGA
CGACAGCGTGGAGCCGCTGCGCAACTTCTCGGGAGCGGAGATGCATCGAGCAGGTTGGTATGTAGTGCACGTGAACGGGA
CGCCGTATGCGCTGACGCCGAATCCGCGACGGTTCTGTGCGCGATTCCGGACGATGCGGCGGCGTGGGTGGATTTCGCCG
TTTGTGAGCATCAACATCAACTCGCACTTTGCGTCGGTGCACATTGCGACGGACGAGGGCCGGATCTGCCGGCCGTACAT
CATTGTGAAGAACGGGCAGTCGCGGCTGCGGGCAGAACATCTGCGGCTGCTGCAGCAGGGACGGGTGACGTTTGACGACT
TTCTGCGGCGCGGCGTGATCGAATACCTGGACGTCAACGAGGAGCAGGACGCGCTGGTGGCGCTGTACGAAGCCGACTGC
ACGGCAGCATCGACACACATGGAGATCGAGCCGTTTACGATCCTGGGGGCAGTGGCAGGACTGATTCCGTTTCCACACCA
CAACCAGTCGCCGCGAAACACGTATCAGTGCGCGATGGGCAAGCAGGCGATCGGGGCGATTGCGTACAATCAGTTCCATC
GGATCGACACGCTGCTGTACACGCTGGTGTATCCGCAGCGGCCGATGGTGGCGACGAAGACGATTGAGCTGGTGCACTAT
GACAAGCTGCCGGCAGGGCAGAACGCGACGGTGGTGGTGATGTCGTACTCGGGCTACGACATTGAGGATGCGCTGGTGCT
GAACAAGGCGTCGATCGACCGGGGGTACGGACGGTGCCAGGTATTCCGCAAGTACGTGGCCGAGATGCAGCGGTTTCCGA
ACGGACGGACAGAGCGAGTAGGCGGACCAGAGCGCGACAAGGACGGCGAGAAGATCAGCAAGCACGCGGCGATTGACAAC
GACGGGCTCGCAGCGGTGGGCTGGCGAGTACAGCACGGTGACGTGATGATCAAGAAGGAGAGTCCGGTAGACCTGACAAC
GACGGGGATCGGAGCCGATCGGGGATCGAACGAGTACCGGGACTCGTCGCTGACGTACCGGATTAACGATCCGAGCTACG
TGGACAAGGTGATGGTGTCGCAGACGGAAAAGGACACGCTGATCTTCAAGGTGCAGACACGACAGACGCGACGACCGGAG
ATCGGCGACAAGTTCTCGTCCCGACACGGGCAGAAGGGTGTGGTGGGCATCATTGTGGAGCAGGAGGACATGCCGTTTGC
AGACTCGGGACTGGTGCCGGACATTATCATGAACCCGCACGGTTACCCGTCGCGGATGACGGTCGGCAAGCTGTTTGAGT
GTCTGACAGGCAAGGCGTCGGTGGTGGCTGGACGACGGGACTACGGATACGGCGATGCGTTCCGGTCACATCCAGTCGAG
GCCATGGGCGAGGAGCTTGTCCGGCACGGCTTCTCGTGGGCCGGCAAGGACTGTTTCACGTCCGGCACGACGGGCGAGCC
GATGGAGGCACACATCTTCAACGGGCCCATCTACTACCAGCGCCTCAAGCACATGGTGCAGGACAAGATGCACTCGCGCG
CTAAAGGTCCGCGGGCCATCTTGACGCGGCAGCCGACTGAGGGTCGGTCACGTGATGGTGGCTTGCGGTTAGGCGAGATG
GAGCGCGACTGTCTCATCGCCTATGGCGCGTCCCAGCTGCTGCTCGAGCGACTCATGTTCAGCTCCGACGCCACATCGCT
CGACCTGTGTCAGCACTGCGGCCTGTTCGGCTACAAGGGCTACTGCCAGACCTGTCGCAGCACGCGCGACGTCACCCAGA
TGACCATGCCCTACGCGGCCAAGCTGCTCGTCCAGGAGCTCATCAGCATGAACGTCGGCGTGCGGCTGCAGCTGGAGGAC
GAGTTTCCGCATCCGGCGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62