GenePrediction:GLEAN_8056 Details

Name: GLEAN_8056
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1338955..1337428 (- strand)
Length: 1528
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1338955..1338761 (- strand)
Length: 195
Type: CDS
Source: GLEAN
Position: GCSC_113:1338185..1337989 (- strand)
Length: 197
Type: CDS
Source: GLEAN
Position: GCSC_113:1337749..1337428 (- strand)
Length: 322
>GLEAN_8056 class=GenePrediction position=GCSC_113:1338955..1337428 (- strand)
ATGTATGCAGACACAGATGCAGAACGCGCCGACTCGTCGGTGTTTTGCACCTGCACTGGGTCATATGTGCTTGATCGTGC
ACAGGAGTGTCGCACGTTGTCGCCGATGGGCGCACGGCTGGTTGGTGTCTGTCCCACGGAAGATGGCAATGCCGTGAATG
TACTTGCATCTCTGGCCAAGTCGACACCCAGCCTCGTATGCTGCATCGTGGCTTGTTTCGTAGCATAATCTCCCGTCTTC
TTCCTCTGTCCCTGCCTCTCCATCTTGACCATACATACCGGCCGAGAGGACGTCATTATTACTACTCCGGCCAAGCAGCA
GCTCGTCATGCATGTGGACACTTGTCCCAGAAGCTTTTCGCATACATAGCCAAGGGGCTCCTGTCTCTCCCCCATATATC
TCATGCTCCTCGTTTCCTTTCTCCTGGCTCACAGTGACTTCACCCGCTGCCAGCTTGCTTGCTGTACTTGTGGAATATGT
TCTGTCTGCAATATTCTGGCATGTGTTTCCTGTTCTCGTTGTCTGACATATTTCCCTAACCCTTTCCCTCTCCCGTTATG
GCCTCCACAACCTGCAGTCATCTATCATTTCTGTCTCATGATGGAGGCTAATTCGGCTTACAGAAAGCTTAGCTATCTCT
TCCTCCTATCCATAGTCTACGTGCATTCGTCACAGCCGCCCCGAGAGGTTGCCGTCGAACACAGAGAAAACGACAACTGC
AGGCCAAGCAATTTTGACCGGGACGCCGCCATACAGACTTCCATCATCAGCATGATACGGGCAGTGCTCTTTGCACGGCG
GCACCACTGTCGGCCCTGTCGGCCCTGTCGGTGCTGCTGGGCCGCGCCGTCCAGGGCGTCGGCTGTGCCGGGCTGGTCCA
GCTTCTATTTCACGGCCGGCTGCTCTCCAGAAAAAACATCGGCCTACTGTTCTACATCAACTTGCCACCGGGGCGGTCAT
GTTTTCGGTGAGTTGGACCGGCCTTGTTTACGCCTCTTTTTGCTGACTAAGCCGCGTGGCAGGTCATTTGCCTTTTGCAC
TCTCTCTACTTCACCATAGTCAAGCTCTACGGGCCTACATATGCAGACACACGGAGGTGGGTGCTCCCCCCTCTCCCCTC
TGCAAGCTGTTGCAAGGTCTCACTTATGTGCAAGGTTGGCGTCTATCTCTCCAAGTGCTTTCTGAACGCTTGGCCGCGCA
ATGTAGTGACGCTGAGAGAGCTGCCCTAGGCATGCGGGCGTCTGCTGCACACACAGAGAAGACGAAACGAGTCCAGACAA
GGCGATATAAGATATTGACCACCTGTCAGTGCATTGCAGCAGCAGCCTTCCTGGACAACGTCGACATCGCCAAGCCAAGG
ACAGGCAGGCGAGAGGAGATTCAGGACGAACATGCCACACACGGGATCTATCTGGCGGTGTGGTTTCGACGGTGGAGAGA
AGAGCCGCTCCTCAAGCAGGTGCGAACGCAGCAGAAACGACGCAACCGTGTTCAGCCGCGACGACGAAGGGAATGTGGGC
AGATGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62