GenePrediction:GLEAN_8058 Details

Name: GLEAN_8058
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1333564..1332511 (- strand)
Length: 1054
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1333564..1333554 (- strand)
Length: 11
Type: CDS
Source: GLEAN
Position: GCSC_113:1333326..1333203 (- strand)
Length: 124
Type: CDS
Source: GLEAN
Position: GCSC_113:1333105..1333058 (- strand)
Length: 48
Type: CDS
Source: GLEAN
Position: GCSC_113:1332996..1332769 (- strand)
Length: 228
Type: CDS
Source: GLEAN
Position: GCSC_113:1332708..1332511 (- strand)
Length: 198
>GLEAN_8058 class=GenePrediction position=GCSC_113:1333564..1332511 (- strand)
ATGAATCCCGAGTAGTATGCATTGTCCCTCTGAATAGCGCATCGCCCTGCCTCAACCTCATTGTCCCCAACCACGGCGTG
GCCATCATACTGACTGACCGTTCCTCTGTCTAGAGTTCTTCCATGGCTTCGCATCGCCCTGACTTTATCCTGCCCGCCTA
TCACCACCCCCAGCAATGTTTCGGCAATATCCCTTTAATCCCTAGCTTTGTCTGACATATCGCCCTCCCACTTCTCAGGT
ACGACTATCTGTTCAAGCTTCTCCTCATCGGTGACTCCGGTGTTGGAAAGTCTTGTCTGTTGCTGCGATTCGCCGACGAT
ACCTATACCGAGTCCTACATCTCAACCATCGGTGTCGACTTTGTACGTATAATCCCGCCCTCCGCAGCGGCTCTTCTGCG
AGATGCCTCCGACTGCATTTCTGCCCATCGGACTCCTCTTTCTAACTGCCGCTGTCTAGAAAATCCGGACTATCGAGCTG
GACGGCAAGACGGTGAAGCTGCAGATTGTAAGTACAGCAAACCCTGGTCCAATACACACAACAGCGGACTAATCAGCCAA
ATCAATAGTGGGACACGGCCGGCCAGGAGCGCTTCCGTACCATCACGTCCTCGTACTACCGTGGTGCCCATGGCATCTGT
GTCGTCTACGATGTCACTGACATGGACTCGTTCAACAACGTCAAGCAGTGGCTGCAGGAGATTGACAGATACGCCACCGA
GGGCGTCAACAAACTGCTTGTCGGCAACAAGAGCGATATGAGCGAGAAGAAAGTCGTCGACTACCAGGTCGCAAAGGTAC
GTCTGCTGCCGCCGCCTTGATTCTTCCCCACCAGTGCCTGCTGACTTTCTTTGTAGGAATTTGCCGACAGCCTCGGCATC
CCCTTCCTCGAGACCTCGGCCAAGAACGCCAACAACGTTGAGCAGGCCTTCCTCACCATGGCTCGCCAGATCAAGGAGCG
GATGGGTAGCACGGCCACTAACAACACCAAGCCCAGCGTGCAGGTCGGCGCCGGTCACGGTGTGTCCAACAACTCGAGCG
GCGGCTGCTGTTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62