GenePrediction:GLEAN_8059 Details

Name: GLEAN_8059
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1325085..1322766 (- strand)
Length: 2320
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1325085..1325074 (- strand)
Length: 12
Type: CDS
Source: GLEAN
Position: GCSC_113:1324963..1324901 (- strand)
Length: 63
Type: CDS
Source: GLEAN
Position: GCSC_113:1324828..1324061 (- strand)
Length: 768
Type: CDS
Source: GLEAN
Position: GCSC_113:1324004..1322766 (- strand)
Length: 1239
>GLEAN_8059 class=GenePrediction position=GCSC_113:1325085..1322766 (- strand)
ATGTTGGCGGTGGTGAGTCACATGCGCATTGCTCTTTGCTCTTACATGGCGGATGACCTGCAGAAGATGTCTTTTTCTAT
TGCCGAGAGGCTGTGCCTGCTAACGACGATGCGATGAGACAGACGAAGAATCTAGCGGAGCTCTGCACTCTGATTATTGA
TGATATTCATGGGGAGCTTCCTTCGGTACGGCTCTCTCCTCTCTCTCTCTCTCTCTCTCTCTCCTGCAGATTGCAGTGAT
GCTGACATGCGTCGCAGCGAATCTTTGCGGCCCTGATCAACCATGGACGGGCCAGCGTGGCGCAGCTGGCGCATCACACG
TCTTTGACTCCACGGCAGCTTCGACACGGGCTCGCAGTCCTGCTGCAGTACGACCTGCTCTACTTCCAGGTCAACGCGGC
TGACGGCACGACCATGTACGATGCCAACCCGGAGGCTGCCTACAACGTGATGCGGTCGGGCAAGGTGCTGGAGATGGTGG
AGAGCCTGTACGGGATGGAGGCCAAGGACGTGGTGCAGAACCTGCTGGCGCTGGGCCACACGCGGATTGCCGACCTGAAG
GACGCGTACACGGCCAAGATTGTACGGTGGGAGGCATCGCTGCGAGAGAGCAACGGGGTTGACAAGACAAACGGTGATCA
TGCGGCGGAGGGACAAGCTCAAGGCGGGCCACACGAGGGCACGGCGATCCGGTCGATGAACCACTTGAACGCGGTGATCT
CGCAGCTGATCCTGGCGGAGGTGGTGGAGGTAGTCAGCCCTGCGAGCTTTGATAGTTTCCCGGACCGGCTGACGCAGGCG
AGAGAATACGTGACGCGCAAGTACTTTCCGGAAGAGATCCGGGGGAAGAAAAAGGACGAGTTCGAGATGCGTCTGGCAGA
GCACCTGCAAGCGCTCCGGGACGAGCCGCGCAAGCTGAAGCGGACGCTGCAGATGAACGGCGGCGGGCGGCAGAAGCTGC
GGAAGCTGATGAATGGCAGCGACGTGGCCAACGGGCACGACGGAGACCAAGATACTCCGCTCGATGTAGGTGTTCTCGGT
GGATGGCGGGCGATTTGCAGCAGTCGTGCTAACGAGGACAGGCCAAAACGATCCTCCGGGTGAACCACGAGCGATGTGCA
GTGCTGCTGCGCAACCAGCGACTGGTGCAGGCAGCATCGGCGGCGGTGGGCGAGACGACAGCGCAGGTGTACGCGGTGCT
GCTGCGACAGCTGACCGAGACGATCCCGCGGTGCCGTGCAAACCCGATGATGGACGCGGCAGGCAGCGAGTTTCTGCGGC
CGCGCGCGATCCAGACGTGGGACGTGTTCGACCACCTGAGCCCGTCGCTAGACGTGTTCACGGGGATCGGCAAGGTGGCA
GGACACGAGATCGACGTGCCGACAGCCGAGCGGCTGGAGCGACATGCCAAGGTGGACGCGTTCATAGCGGGCGACGATGG
CGACGGCAGCGGTGCAGACGAGGATGACATGGACGAGGAGGACTACGACTCGGAGGGCGAGGTGCATCTAACGCCAGTGA
TCCGACAGGCAGCAGCGATCAATGGAGAGAGCAACGGCCACGGCCACAGCAACGGCCACAGCAACGGCCACAGCAACGGC
AACAGCAACGGCAACGAAGCCGAGCACAACACGCCACGAGTCAAGTTTGCCGAGGGCGTGGCAGCAGCAGCGCCGTCGGC
CGCGGCGAGCCAAGAGACGCGGCTGCAGCAGATGCGACAGCACCTATTGCTGCTGTGCGACGACCGGCTCAAGCTGCTGC
GACACTGCGAGCGCGGGCAGTGGACGGTAGACTTTGTGCCGCTGTTGCGACGGCTGCGCGAGGCCGAGCTGGACGACGCG
ATTGAGCGGCAGACGGGACGGCAGGGACTGCGGCTGGCGCGGATTCTGCGCGACAAGGGCAAGCTGGACGAGAAGACGCT
GCCGGGGCTGGCGCTGATGAAGAAGAGCGAGGTGCAGCACAAGATGTTGGAGCTGCAGGCACACGGCTTTGTCGACGTGC
AGGAGGTCCCGCGCGACAACAACCGGTCGGCCAGCCGGACGGTGTTTCTCTGGTACTGCGACGTGGCCCGCGCCGAGGAC
ATGCTGCTGGACCACGCCTACAAGGCCATGGCGCGCTGTCTGCGTGTCCGTGACGTCCATCGCCAGGCCAGCCGCGAGGT
GCTCGCGTTTGTCGAGCGGCCCGACGTCAAGGGTCGCGAGCGTGAGGCCCTGGAGAAAAAGTACTTTGACCGGTATCAGC
GCTACTGCGACGTCGAGCAGAAGCTGATCGGACAGGTCATGCGGCTGGACAGCCTGGTGGCGACGTTGCGGGATTTTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62