GenePrediction:GLEAN_805 Details

Name: GLEAN_805
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_132:91573..93337 (+ strand)
Length: 1765
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_132:91573..91795 (+ strand)
Length: 223
Type: CDS
Source: GLEAN
Position: GCSC_132:91852..91987 (+ strand)
Length: 136
Type: CDS
Source: GLEAN
Position: GCSC_132:92044..92256 (+ strand)
Length: 213
Type: CDS
Source: GLEAN
Position: GCSC_132:92320..93337 (+ strand)
Length: 1018
>GLEAN_805 class=GenePrediction position=GCSC_132:91573..93337 (+ strand)
ATGTCTGAGAAGCAGGACATCAACAGCAATGCGGTGCGGTCGGGATCGGCATCGCTGTCGGGCTCGCTCGACGGCCCCAA
GGCCGGCAAGGTGCTGCAGGTCGATCTCGAGGATGAGCAGCTCTTCTCGATGGGCTACGAGCAGCACATGCGGCGTGGCT
TCAACGCCTGGTCCATGACGGCCTTTTGCCTCACCGGTCTGGGGCTGCTGCCGTCTGTGGGAGGTGCGTCTTTTTTGTCT
GCCGCTCTCCCTCTTGCTACCCTCTCGCTGACCGTCCAGGCACGCTCTGGTACAGCCTCGGATACCTTGGCCTTATGCCC
ATGACCTGGGGCTGGCTGGCGGCTTCGTTCTTTATCATGACCATGGTCTTCTCCATTGCGGAGATGAGCTCGGCCATGCC
GACGGCTGGAGGGCTGTAAGTCACGATGCCTGCTCTGTCCAACTGTCCGTGACTAATGCGATGCACTGTAGCTACTACTG
GACTTTCAAGTGTGCCCCGCCGAAGCTCAAGAAAGTCTCCTGCTGGATCACAGCCTGGAGCATGGTCATGTCAACCGCCC
TCAGCGGAGCCTCGTTCTTCATGACACAGGCCCAAATGATCCAGGCGCTCGTGGTCATGTTCCATCCCGATTTTGATCCC
ACGGCATGGCAGCTGTACCTCATATACCTTGGTTGTCTGATTGTGTGCGTTTTTCTTCTTTTCTTTTTTTCATCTTCAAT
CTCTCCCAGCTCATGCTAACTTCCCAGATGTGGCATGGTCATGGTCCTTCCCAGCAACATCCTGGGCAAGATCAGCAACG
TATTTGCCTGGCTGGGCACGGTGACCTTCTTTGTCCTCTTGATTGCGCTGCCGATCTACGCGCACAAGAACCGATCGTAC
AACACGGCCCACGACATGTTTTTCTCGCGGGTCAATCAGACCGGCTTCAAGAATGAAGGCCTCGTCTTCCTGCTGACCTT
TCTGGCGCCCTGCTGGTGCATCAGTGGCTACGACTCGACGGCCCACCTGTCGGAGGAGACAGAGAACGCGTCTGTGGTGG
TGCCGCGAGCCATGTGGACGTCGTGTGTCTTTATCGCCATCGTCGGCTACATCTTCAACGTCGTGCTGGCCTATGCCGCC
GTTGACCTGGACGGCATTCTGGGCTCGCCTCTAGGCCAGCCTCTGGCCGCCATCATGGTCAGCGCCATGGGCGACGGCGC
CTTTCCGAAACTTCTCTGGATCTGCACTGTGCTGTCCAACTTTGGCATCGTCTTCGTCATGAACACGTCGGGCACCCGCA
TCTTCTGGGCCTACGCTCGTGACGGCGCTCTGCCCTTCTCGCGCTTCCTCAGCGCCATCAACAAGACTACCCGTACGCCC
ATGAATGCGTCCGTGACCTTGTCGGCCGTTTTTGCTCTCATCGGTCTCATCTCGCTCGGCTCCACGACCGCGCTGCAAGC
CTTCTTTTCCGGCTCGTCCGTCACCGGTGCGGCCGCCTACCTGATGCCCGTGCTCATGCGCTGCCTCTACGAGGACAATC
CCGAATATGTTCCCGGTCCGTTTACGCTCGGCCGCCTGTCTCGGCCGATCCGCTGGACCGCCGCACTCTGGACCATTTTC
ACCCTCCCGCTCCTGGCCTTTCCCTCGACTGCACACCCGGACGCGTCGACGTTCAACTGGAGCGTCGTCTTCTATGTCGG
CATGTTCGTCATCGTGCTGCCGTGGTACTTTCTCCGGGCGCGCAAGTGGTTCACGGGCCCGGGAGAAAATGTGCGCTCAG
AGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62